ID: 996893585

View in Genome Browser
Species Human (GRCh38)
Location 5:128453716-128453738
Sequence GCTGAAATGCAGAGTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996893579_996893585 18 Left 996893579 5:128453675-128453697 CCTTTCTCTTTATTATTCATCTC 0: 1
1: 0
2: 7
3: 91
4: 769
Right 996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996893585 Original CRISPR GCTGAAATGCAGAGTGGGGA AGG Intronic
No off target data available for this crispr