ID: 996897280

View in Genome Browser
Species Human (GRCh38)
Location 5:128500378-128500400
Sequence CTATATCATTTGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996897280 Original CRISPR CTATATCATTTGAGGGAAGA GGG (reversed) Intronic
900895148 1:5478257-5478279 CTAGATCTTTGGAGGGGAGAAGG - Intergenic
902647225 1:17808328-17808350 CAATAACATTTGAAGGAAAAAGG - Intronic
904218369 1:28942945-28942967 CAATATCATGTGAGGTAATATGG + Intronic
905842143 1:41190535-41190557 CTAAATCATTAGGAGGAAGAGGG + Intronic
905921722 1:41723985-41724007 TTATAGCATTTGAAGGAAGTTGG - Intronic
909166619 1:72234290-72234312 CTATATCCTTTGCAGGAACATGG - Intronic
909896709 1:81080225-81080247 TTATTTAATTTGACGGAAGATGG - Intergenic
912098716 1:106179248-106179270 TTATCTCAGCTGAGGGAAGAAGG - Intergenic
912895398 1:113581965-113581987 CTTCATCATTTAAGGGGAGAGGG - Intronic
916251262 1:162740631-162740653 ATATATAATGTGAGAGAAGATGG - Intronic
916472726 1:165139732-165139754 TTATATCATTAGAGAGGAGAAGG + Intergenic
918412011 1:184269432-184269454 CTCTCTTATTTGAGAGAAGAGGG + Intergenic
918577190 1:186076585-186076607 CTTTATCACTTGAGGTCAGAGGG - Exonic
919493224 1:198231413-198231435 ATATATCATTTGAGGTCAGTTGG + Intronic
920283553 1:204862242-204862264 CTTTATCCTATGAGGGTAGATGG - Intronic
923690083 1:236184062-236184084 CCTTATCTTTTGAGGGAAAATGG + Intronic
1063566757 10:7177924-7177946 CTAGACCATGTGAGGGCAGAGGG + Intronic
1063603370 10:7501556-7501578 CTATATAATGTGATTGAAGATGG + Intergenic
1063926841 10:10986869-10986891 CTATATCAAAGGAGGGAAGAAGG + Intergenic
1066629739 10:37447380-37447402 CTACATCATCTCATGGAAGAAGG - Intergenic
1068425555 10:56858463-56858485 CTATATCATCTGAGTAAAAAAGG - Intergenic
1070206211 10:74265150-74265172 CTAAATCAATTTTGGGAAGAGGG - Intronic
1071214813 10:83388445-83388467 TTATGTCTTTTGAGGGAACATGG - Intergenic
1072599267 10:96909178-96909200 CTACACCATTTGAGGGGTGAGGG - Intronic
1075158823 10:120004802-120004824 ATATATCTTTTGGGGGAACACGG + Intergenic
1075578426 10:123597771-123597793 CCACATCATTGAAGGGAAGAGGG + Intergenic
1077838499 11:5946463-5946485 CTATATCATTACAGTCAAGATGG + Intergenic
1079471573 11:20783162-20783184 CTATATCCATTGTGGGGAGAAGG + Intronic
1079653516 11:22960525-22960547 CCAATTCATTTGAGGGAAGCGGG + Intergenic
1080353284 11:31410915-31410937 ATATATCAGTTTAGGGAAAATGG - Intronic
1081106415 11:39075483-39075505 CTATTTTATTTGAGGTAAGTTGG - Intergenic
1082247006 11:49935553-49935575 TTATAACATTTTAGGTAAGAAGG - Intergenic
1082988487 11:59187437-59187459 CTGTAACATGTGAGTGAAGAAGG + Intronic
1085537165 11:77228821-77228843 CTATGCCATTTCATGGAAGATGG + Intronic
1086483754 11:87274373-87274395 AGAAAACATTTGAGGGAAGAGGG - Intronic
1086599767 11:88618379-88618401 CTAAATCATTTAAAGAAAGATGG - Intronic
1088627050 11:111737085-111737107 CTATATTATGTGAGGAAAGTGGG + Intronic
1090432644 11:126659116-126659138 CTATATCCTTGCAGGCAAGAGGG - Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1093487839 12:19671277-19671299 CTACATCATTTCATGGCAGAAGG + Intronic
1095823842 12:46510405-46510427 TTATGTCCTTTGAGGGAACATGG - Intergenic
1095874566 12:47066617-47066639 CCATAACTTTTGTGGGAAGAAGG - Intergenic
1096823303 12:54254500-54254522 CTAAATCATTTGAGCTAATATGG + Intronic
1098321957 12:69254811-69254833 CTAAATTATTTGAGGGAGGGAGG - Intronic
1098386595 12:69925984-69926006 ATTTCTCATGTGAGGGAAGAAGG - Intronic
1098980400 12:76949920-76949942 CTATTTCCTTTGAGGGAAGAGGG + Intergenic
1099070081 12:78035280-78035302 CTTTATCAAATGAGGGAAAATGG - Intronic
1100497731 12:95141611-95141633 CTGTATCATTTTAGGGAGGAGGG - Intronic
1104169506 12:126266520-126266542 CTATGTCATTTGTGGCAACATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107275121 13:38669468-38669490 TCGTATCATTTCAGGGAAGAAGG - Intergenic
1107790543 13:43998016-43998038 CTCTATCACTTCAGGAAAGAAGG - Intergenic
1109602925 13:64656769-64656791 TTCTATCATTTGAGGAAACAGGG + Intergenic
1109903332 13:68803578-68803600 ATATATTTTTTGAGGGAGGATGG - Intergenic
1110232124 13:73177993-73178015 CTATACCATTTCAGGGTACAAGG + Intergenic
1110861572 13:80349995-80350017 ATAAAACATTTTAGGGAAGAAGG + Intergenic
1111727038 13:92024753-92024775 TTAAATCTTTTGAGGTAAGAGGG - Intronic
1111961309 13:94813641-94813663 ATAGATTATTTAAGGGAAGATGG + Intergenic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1113229872 13:108201428-108201450 TTATATTATTTAAGGGAATAAGG - Intergenic
1115411920 14:33084801-33084823 CTATCCCATATGAGGGCAGACGG - Intronic
1117393822 14:55289137-55289159 CTAAATCATTTGAGAGAAAAGGG - Intronic
1117867107 14:60161563-60161585 CCATGTCATGTGAGGGAAGGTGG - Intronic
1121598141 14:95181550-95181572 TTGCATCATTTGAGGGCAGAGGG - Intergenic
1126651702 15:50929571-50929593 CTGTATCATATGAGGAAAGAGGG + Intronic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1137513776 16:49124823-49124845 CTAGGTGAATTGAGGGAAGAGGG - Intergenic
1138460066 16:57142773-57142795 CTAGCTCATTTCAGGGAAGTTGG - Intronic
1138755149 16:59475548-59475570 TTATGTCATTTGTGGGAACATGG + Intergenic
1138777618 16:59743241-59743263 CTATACTATTGGAGGGAAAATGG - Intronic
1139088129 16:63613969-63613991 CAACATCCTTTAAGGGAAGATGG - Intergenic
1139706404 16:68743695-68743717 CTATCTCCTTTGAGGGCACAAGG + Intronic
1143722830 17:8824886-8824908 CTTTATCATTTGACTGATGAGGG - Intronic
1151511184 17:74561203-74561225 ATATTTAATTTGAGTGAAGATGG - Intergenic
1153487697 18:5617069-5617091 ATACATCACTGGAGGGAAGAAGG - Intronic
1155721158 18:29013357-29013379 TTATCTTATTTGGGGGAAGAGGG - Intergenic
1156201316 18:34835457-34835479 CTCATTCCTTTGAGGGAAGAAGG + Intronic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1156536447 18:37869194-37869216 CTAGGTCATTGGAGGGAGGAGGG + Intergenic
1156708931 18:39918114-39918136 TTCTATCATTTATGGGAAGATGG + Intergenic
1156735411 18:40252182-40252204 CTCTATCAATAGAGAGAAGAAGG - Intergenic
1157030768 18:43905010-43905032 CTATATCTATTGAAAGAAGAGGG + Intergenic
1159354306 18:67317344-67317366 CTTTATGACGTGAGGGAAGAGGG - Intergenic
1160308986 18:77770791-77770813 CTATTTCATTTGATAGAAAAGGG + Intergenic
1161357896 19:3829408-3829430 CTAAATCATTTCAGGGTGGAGGG + Intronic
1162361277 19:10221952-10221974 CTATATAACTTGAAAGAAGAAGG + Intronic
1163866271 19:19776132-19776154 CTATAGCAGTTTAGGAAAGAAGG + Intergenic
1166623954 19:44333055-44333077 AGACATCATTTGAGGTAAGAAGG + Intronic
930241931 2:48944696-48944718 CCTAAACATTTGAGGGAAGACGG - Intergenic
930307089 2:49688192-49688214 CTTTAACATTTGGGGGAAGATGG - Intergenic
932251396 2:70247734-70247756 ATATATCAATTGAGGGGAAATGG - Intronic
935953257 2:108350239-108350261 CTATATCATCTGGGAGAAGTAGG + Intergenic
938155283 2:128932443-128932465 TTATATAATTTGAGAGAACAGGG + Intergenic
938877019 2:135542691-135542713 ATAACTAATTTGAGGGAAGAGGG + Intronic
939253139 2:139709141-139709163 CTGTATCATCCCAGGGAAGAGGG + Intergenic
940888218 2:159009429-159009451 TTCTATCATTTGAGGTAACATGG + Intronic
941318945 2:164030845-164030867 TTATCACATTGGAGGGAAGAGGG + Intergenic
941831090 2:169960487-169960509 CTTTATCATATGAAAGAAGAGGG + Intronic
945516088 2:210764647-210764669 CTATATAATTTGAGGGACTCAGG + Intergenic
947020077 2:225665058-225665080 CTATATTATTTGTGGAGAGAAGG - Intergenic
947295319 2:228624381-228624403 CTTTATCCTATGAGGGAACATGG - Intergenic
1169398469 20:5258144-5258166 CTATATAATTTTAGAGAAAAAGG + Intergenic
1170201401 20:13748383-13748405 ATATATCCTTTGAGGGAGGAAGG - Intronic
1171568142 20:26214938-26214960 CTATAACATTCATGGGAAGAAGG - Intergenic
1174190821 20:48739171-48739193 TTAGCTCATTTGAGAGAAGAAGG - Intronic
1177283469 21:19016412-19016434 CTATATAATTATAGGTAAGATGG + Intergenic
1177389864 21:20454062-20454084 TTACATCATATAAGGGAAGACGG + Intergenic
1178281615 21:31287989-31288011 ATACATCCTTTGAGGAAAGAAGG + Intronic
1182364012 22:29765882-29765904 GTAGATCATTTGAGGGAAGATGG - Intronic
949166604 3:950324-950346 TTATATCATTTGGGGATAGATGG + Intergenic
952855427 3:37766593-37766615 CTTTAGCCTTTAAGGGAAGATGG + Intronic
956382148 3:68675737-68675759 CTAATACATTTAAGGGAAGAGGG - Intergenic
957110708 3:75953065-75953087 CTATAACATTCATGGGAAGAAGG + Intronic
958574765 3:95934770-95934792 CTAGATCATTTGAGGATAAAAGG - Intergenic
959459582 3:106608732-106608754 CTATATGCTTTGAGGAAATATGG + Intergenic
960291953 3:115896805-115896827 CTTTCAAATTTGAGGGAAGAGGG + Intronic
960336255 3:116421069-116421091 CTATATAATTTTAGAGAAGAAGG + Intronic
960442020 3:117700495-117700517 CTAAAACATTCAAGGGAAGATGG + Intergenic
960450096 3:117795932-117795954 ATATATCATTTCAGAGTAGAAGG + Intergenic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
960603679 3:119482945-119482967 CTAGGTCTTTTGAGGGAGGATGG + Intronic
960926170 3:122796572-122796594 CTATAACATAAGATGGAAGAAGG + Intronic
962027174 3:131560505-131560527 CTCTGTCCTTTGTGGGAAGAGGG - Intronic
962357651 3:134708726-134708748 CTTTATCATTTGGGGGCAAAAGG - Intronic
964076283 3:152696474-152696496 TGATGTCATTTGAGGGCAGAAGG - Intergenic
964937003 3:162102222-162102244 CCATATCTTTTGAGGCAACATGG + Intergenic
966887474 3:184384731-184384753 CTAGAACATTTGAGGGATGGTGG + Intronic
967413286 3:189188679-189188701 GTAAATTATATGAGGGAAGAGGG - Intronic
968250858 3:197211926-197211948 TCATGTCTTTTGAGGGAAGATGG + Intronic
969180078 4:5433572-5433594 CTATAACATTTAAGGGAGGAAGG + Intronic
972194061 4:36631314-36631336 CTATATCATTGGATAAAAGAGGG - Intergenic
972718647 4:41674351-41674373 CTTTGTCTTTTGAGGGAAAAGGG - Intronic
973949698 4:55999082-55999104 CTATATTATTTTTAGGAAGATGG + Intronic
974344829 4:60665666-60665688 AAATAACATTTGAGGAAAGAGGG - Intergenic
975304583 4:72834844-72834866 TCATGTCATTTGAGGGAACATGG + Intergenic
976979347 4:91207132-91207154 ATATATCATTGGATAGAAGAAGG + Intronic
977181305 4:93878547-93878569 ATTTGTAATTTGAGGGAAGAGGG - Intergenic
978196682 4:105980264-105980286 CTATATAATATGAGGGAGAATGG - Intronic
981384610 4:144114600-144114622 CTTTCTGATTTGAGGGAGGAGGG - Intronic
982466420 4:155738840-155738862 CTAGTTCATTTGAGAGATGAGGG + Intergenic
984264974 4:177487543-177487565 ATGTGTCATTTGAGGGAAAAGGG - Intergenic
984542191 4:181053042-181053064 GTATTCCATTTGAGGAAAGAAGG - Intergenic
984899971 4:184577443-184577465 CTATAGCAGTTGAGGGTAAATGG - Intergenic
991187789 5:63830739-63830761 CTATTTCATGTGAGGGCACAGGG + Intergenic
992056288 5:72994798-72994820 TTATATCTTTTGTGGGAACATGG + Intronic
992511115 5:77436061-77436083 ATATATGATTTGAGGAAACAAGG - Intronic
995704800 5:114977179-114977201 CTACATCATTCCAGGGCAGAGGG + Intergenic
996523781 5:124455541-124455563 CTACATCATTAGAAGGAAGGGGG + Intergenic
996813938 5:127552977-127552999 ATATATTATTTGAGGGGAAAAGG - Intronic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
997224781 5:132201315-132201337 GTAGATCATTTGAAGGAAAAAGG - Intronic
999817342 5:155190393-155190415 CTCTAGCATTTGAGTGAAGCAGG + Intergenic
1000660981 5:163938021-163938043 TCATATCATTTGCTGGAAGATGG + Intergenic
1000844514 5:166262710-166262732 ATTTATCATTTGAAGGTAGAAGG - Intergenic
1000931100 5:167252440-167252462 CGTTGTCATTTGGGGGAAGAAGG + Intergenic
1005603163 6:27447873-27447895 CTACATCATCTGATGGCAGAAGG - Intergenic
1006907553 6:37543251-37543273 TTATCTCATTTGAGTGAAGAGGG + Intergenic
1008102510 6:47407160-47407182 CTATGTCATTTCATGGCAGAGGG - Intergenic
1009837422 6:69020511-69020533 TAATAACATTTAAGGGAAGAAGG - Intronic
1011447996 6:87463391-87463413 TTATAGCATGTGAGTGAAGAAGG - Intronic
1014657281 6:124123298-124123320 CTAGAGCATTGGAGGGGAGAAGG + Intronic
1014743004 6:125168396-125168418 GGATATCATTTGAGGGGTGAGGG - Intronic
1015053076 6:128865419-128865441 ATGTATCAATTGAGGGAAAAAGG - Intergenic
1015870516 6:137771752-137771774 CTATCTCCTTTGAGAGAAAAAGG + Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1017387720 6:153905630-153905652 TTATATCTTTTGGGGGAAGATGG + Intergenic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1020639567 7:10738505-10738527 ATATCTCATTTGAGGGGGGAAGG + Intergenic
1021539129 7:21737457-21737479 GTATTTCATTTGATGGAAAATGG + Intronic
1022534341 7:31086487-31086509 GTATCTCCTTTCAGGGAAGAAGG - Exonic
1023048161 7:36229362-36229384 CTATATCATTTGGGGAGGGAGGG + Intronic
1024530207 7:50385026-50385048 GTATTTCATTTGAGGCATGATGG + Intronic
1026781808 7:73273192-73273214 CTTTATCATTTGACGTAAAAAGG - Intergenic
1027022659 7:74826626-74826648 CTTTATCATTTGACGTAAAAAGG - Intronic
1027065353 7:75119283-75119305 CTTTATCATTTGACGTAAAAAGG + Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1034281457 7:149857756-149857778 ATAGATCTTTTGAGGGGAGAGGG + Intronic
1035530761 8:349451-349473 ATATGTCATTTTAGGGAAGAGGG + Intergenic
1038176005 8:25182936-25182958 ATAAATTATTTTAGGGAAGATGG + Intergenic
1042451347 8:68950577-68950599 CTATTTCAGTTGAAAGAAGAAGG - Intergenic
1044775602 8:95684156-95684178 CTATTTAATTTCAGAGAAGAGGG + Intergenic
1046037977 8:108867102-108867124 CTATAGGAATTGAGGGAACATGG - Intergenic
1046320341 8:112566470-112566492 CTATATCATTAGGGGCAAGGTGG - Intronic
1046928644 8:119821412-119821434 CCATTTCATTTAAGGCAAGAGGG - Intronic
1048518950 8:135136414-135136436 CTGAATGATGTGAGGGAAGAGGG + Intergenic
1048937509 8:139369113-139369135 CTGTAGCATTTCAGGGAAGTTGG - Intergenic
1049937761 9:516059-516081 CAATAATATTTAAGGGAAGATGG - Intronic
1050103252 9:2140327-2140349 GTATATCATTTGAAGGCACAGGG + Intronic
1050139254 9:2500354-2500376 CTATAGCATTAGGGGGTAGATGG + Intergenic
1051575568 9:18611737-18611759 CTTTATTATTTGAGCTAAGATGG - Intronic
1052495684 9:29220604-29220626 CTGAATCATTTTAGGGAACATGG + Intergenic
1054927533 9:70603416-70603438 CTATATCGTGTTAGTGAAGATGG - Exonic
1055991376 9:82110075-82110097 CTAAATCTTTAGAGGGAAAATGG + Intergenic
1058276959 9:103055178-103055200 CTATATCACCTGAGGGGAGAGGG + Intergenic
1058639619 9:107070166-107070188 ATATATTATTTTAGGGGAGACGG - Intergenic
1186394964 X:9198713-9198735 TTATTTCATTTGAAGAAAGAGGG - Intergenic
1186695042 X:12021467-12021489 CAATATCATTTAAAGGAACAAGG + Intergenic
1187110006 X:16288287-16288309 CAATACCATGTCAGGGAAGATGG - Intergenic
1187207541 X:17197363-17197385 TTTTATGATTTGAGGAAAGATGG - Intergenic
1188344023 X:29042062-29042084 TGATATCTTTTGGGGGAAGAAGG - Intronic
1192845710 X:74905275-74905297 ATATATTATTTATGGGAAGAGGG + Intronic
1194160466 X:90443722-90443744 CTATATCATTTCAGTTAAAAAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1198471784 X:136953730-136953752 CTATGTCAGTTGAAGGAAAATGG - Intergenic
1198642053 X:138767114-138767136 CTATATGATGTGAGGTGAGAGGG + Intronic
1199071483 X:143480670-143480692 TTATATCCTTTGAAGGAACATGG - Intergenic
1199208391 X:145176355-145176377 CTATATCATTTCATGGCTGAAGG - Intergenic
1199354831 X:146849908-146849930 CTTCATCCTTTGAGGGAAAAGGG - Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1199498338 X:148480127-148480149 GAATATCATTAGAGGGAAAAAGG - Intergenic
1200506756 Y:4020666-4020688 CTATATCATTTCAGTTAAAAAGG + Intergenic
1200685005 Y:6250257-6250279 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200990535 Y:9341527-9341549 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200993197 Y:9361844-9361866 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1200995851 Y:9382115-9382137 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200998515 Y:9402467-9402489 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201001025 Y:9470997-9471019 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1201003692 Y:9491325-9491347 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201006348 Y:9511606-9511628 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201063040 Y:10065437-10065459 CTATATTGTTTCAGGAAAGAGGG - Intergenic
1201849465 Y:18462196-18462218 CTATAGCATTTCTGGGAATAAGG - Intergenic
1201883853 Y:18858179-18858201 CTATAGCATTTCTGGGAATAAGG + Intergenic