ID: 996902321

View in Genome Browser
Species Human (GRCh38)
Location 5:128556564-128556586
Sequence CAATGAGAACAGCTGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37875
Summary {0: 1, 1: 15, 2: 674, 3: 21435, 4: 15750}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996902316_996902321 16 Left 996902316 5:128556525-128556547 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 996902321 5:128556564-128556586 CAATGAGAACAGCTGGACCCAGG 0: 1
1: 15
2: 674
3: 21435
4: 15750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996902321 Original CRISPR CAATGAGAACAGCTGGACCC AGG Intronic
Too many off-targets to display for this crispr