ID: 996906040

View in Genome Browser
Species Human (GRCh38)
Location 5:128601432-128601454
Sequence GAGTGGGGCTGGGGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1360
Summary {0: 2, 1: 0, 2: 13, 3: 143, 4: 1202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996906040_996906050 -2 Left 996906040 5:128601432-128601454 CCCACTTCCCCCCAGCCCCACTC 0: 2
1: 0
2: 13
3: 143
4: 1202
Right 996906050 5:128601453-128601475 TCACTATGATTTCCAGCCACAGG 0: 1
1: 0
2: 3
3: 23
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996906040 Original CRISPR GAGTGGGGCTGGGGGGAAGT GGG (reversed) Intronic
900101633 1:964536-964558 CAGTGGGGCTGCGGGGAGGGGGG + Intronic
900158423 1:1212593-1212615 GGGAGGGGCTGGGGGGGGGTTGG - Intronic
900338285 1:2175532-2175554 GAGTGGGGTTGGGTGGATATTGG - Intronic
900395203 1:2450625-2450647 GCGGGGGGCAGGGGGGGAGTTGG - Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900589394 1:3453064-3453086 GTGTGGGGTTGGGGGTAACTTGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900850247 1:5137028-5137050 GAGTGGGGGAGTGGGGAAGTAGG - Intergenic
900850249 1:5137036-5137058 GAGTGGGGGAGTGGGGGAGTGGG - Intergenic
900850257 1:5137052-5137074 GAGTGGGGGAGCGGGGGAGTGGG - Intergenic
900850269 1:5137076-5137098 GAGTGGGGGAGCGGGGAAGTGGG - Intergenic
900850286 1:5137116-5137138 GAGTGGGGGAGTGGGGGAGTGGG - Intergenic
900850290 1:5137124-5137146 GAGTGGGGGAGTGGGGGAGTGGG - Intergenic
900850294 1:5137132-5137154 GAGTGGGGGAGTGGGGGAGTGGG - Intergenic
900850298 1:5137140-5137162 GAGTGGGGGAGTGGGGGAGTGGG - Intergenic
900931649 1:5741837-5741859 GACTGGGGACTGGGGGAAGTGGG + Intergenic
900991563 1:6100528-6100550 GGGTGGGGCTGGGTGGCAGTGGG - Exonic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
901442849 1:9290067-9290089 GTGTGGGGGTGGGGTGGAGTTGG + Intergenic
901466445 1:9424554-9424576 GGGTGGGGGTGGGGTGAAGGTGG + Intergenic
901656126 1:10770705-10770727 GGGTGGGGCTGGGAGGAAGCTGG - Intronic
901877590 1:12175662-12175684 GAGTGGGGCTTGAGGGAGCTGGG - Intronic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902070243 1:13728490-13728512 CAGCGGGGCTGTGGGGAAGAAGG + Intronic
902332141 1:15735936-15735958 GGGTGGGGCAGGGGCGGAGTTGG + Intergenic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902519858 1:17010096-17010118 GAGACGGGCAGGGGGGAAGGGGG - Intronic
902535816 1:17118880-17118902 GAGAGGGGCTGGGTTGAGGTGGG + Intronic
902551117 1:17220122-17220144 GAGTGGGGGATGGGGGAGGTGGG + Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903126264 1:21250130-21250152 GAGTGGGGGTTGGGGCCAGTGGG - Intronic
903319847 1:22536158-22536180 GAGTAGGGCTGTGGGGCAGGTGG + Intergenic
903349582 1:22710165-22710187 GGGTGGGGCTGGGGGGAGGGTGG - Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903609239 1:24597966-24597988 TGGTGGGGGTGGGGGGAACTTGG + Intronic
903731623 1:25500517-25500539 GGGTGGAGTTGGGGGGTAGTTGG + Intergenic
903831435 1:26177602-26177624 GGGTGGGGCTGGGGTAGAGTTGG + Intronic
903951786 1:26999786-26999808 GGGTGGGGCTGGGTGGCTGTGGG + Intronic
904094226 1:27965266-27965288 GAGTGTGGCAGGGGGTAAGGGGG + Intronic
904171806 1:28596685-28596707 GGGTAGTGGTGGGGGGAAGTGGG - Intronic
904292593 1:29497593-29497615 GATTGGGGCTGGCGGGAAGATGG - Intergenic
904301524 1:29557541-29557563 GTGTGGGACTTGGTGGAAGTTGG + Intergenic
904377667 1:30091923-30091945 GAGTGGGGAGGGGAGGGAGTAGG + Intergenic
904385633 1:30140353-30140375 GAGGGGTGCTGGGAGGAAGCTGG + Intergenic
904494581 1:30879469-30879491 GAGGGGAGCTGGGGAAAAGTTGG - Intronic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904831229 1:33307729-33307751 GGGTGGGGGTGGGGGGGAGGTGG - Intronic
904842070 1:33379314-33379336 GTGGGGGGCAGGGGGGCAGTGGG - Intronic
904989110 1:34577181-34577203 GTGTGGGGCTGGGGAGGTGTTGG - Intergenic
905124404 1:35707255-35707277 GAGAGGGGCTGGGAGGCAGATGG + Intergenic
905124765 1:35708545-35708567 GAGTAGGGCTGGGAGGAGGGGGG + Intergenic
905441800 1:38000675-38000697 GAGTGGAGCGGTAGGGAAGTGGG + Intronic
905739330 1:40355965-40355987 TAGTGGGGGTGGGGGAAAGTGGG - Intronic
905932526 1:41799793-41799815 GCTTGGGGTTGGGGGGAAGGGGG - Intronic
905935574 1:41821519-41821541 GTTTGGGGCTGGGGTGGAGTAGG - Intronic
906036253 1:42751870-42751892 CAGTGGGGGTGTGGGGACGTGGG - Intronic
906073656 1:43036012-43036034 GAGTAGGGCCGGGGGGACCTAGG - Intergenic
906149295 1:43578232-43578254 GGGTGGGGCTGGCGGGGAGGGGG + Intronic
906210842 1:44011426-44011448 GGGCAGGGCTGGGGGGAAATGGG + Intronic
906227658 1:44134800-44134822 GAGTGGAGGTAGGGAGAAGTAGG + Exonic
906274741 1:44507451-44507473 GATTGGGGGTGGGGTGAAGGGGG + Intronic
906279346 1:44542878-44542900 GAGTGGGGCTGGGGGCCGGAGGG + Intronic
906781050 1:48573143-48573165 GGAGGGGGCTGGGGAGAAGTTGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907415351 1:54310583-54310605 GGGTGGGGGAGGGAGGAAGTGGG - Intronic
907449954 1:54539530-54539552 GCTTGGGGATGTGGGGAAGTGGG + Intergenic
907476608 1:54710116-54710138 GAGCGCCGCTGGTGGGAAGTGGG - Exonic
907557592 1:55358231-55358253 GAAGGGGGCTGGGGTGAAATGGG + Intergenic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
907847296 1:58220481-58220503 GCAAGGGGCTGGGGGGAAGGTGG + Intronic
908464328 1:64376696-64376718 GGCTGGCGGTGGGGGGAAGTGGG - Intergenic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
909919539 1:81364101-81364123 GAGTGGGGGTAAGGGGGAGTGGG - Intronic
910758734 1:90716198-90716220 GAATGGGAATGGGGGGAGGTAGG - Intronic
911176016 1:94819579-94819601 GAGAGGAGGTGGGGGGAGGTCGG + Intergenic
911575665 1:99574417-99574439 ATGTGGGGCTAGGGAGAAGTGGG + Intergenic
911767917 1:101701651-101701673 GAGTGGGGAGGGGGGGGAGGGGG - Intergenic
911995293 1:104758231-104758253 GAGGGGGGGTGGGGGGGAATGGG + Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912560731 1:110549560-110549582 TGGTGGGGCTGGGAGGAAGGAGG + Intergenic
912974979 1:114321332-114321354 GAGTAGGGGTGGGGGAATGTGGG + Intergenic
913042405 1:115040218-115040240 GAATGAGGCTGGTGGGAAGATGG - Intergenic
913219219 1:116645941-116645963 GAGTGGGGATGGGAGGTAGCAGG + Intronic
913229683 1:116731449-116731471 GAATGGGGCTGGGTGTAAGTTGG - Intergenic
913460619 1:119082633-119082655 GAGAGGGGTTGGGTGGGAGTGGG - Intronic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
914514502 1:148362612-148362634 GGGTGGGGGTGGGGGGCGGTGGG - Intergenic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915472840 1:156136119-156136141 GAGGTGGGCTGGGGAGACGTCGG + Exonic
916275309 1:162987643-162987665 GAGGGGTGCTGCAGGGAAGTCGG - Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
918264758 1:182831453-182831475 AAGTAGGGTTGGGGGGCAGTGGG + Intergenic
918329501 1:183444444-183444466 GCGTGGGGCTTTGGGGAAATAGG + Intergenic
918515678 1:185360005-185360027 GTGCGGGGCTGGGAGGAGGTAGG - Intergenic
919207670 1:194437786-194437808 GGGTGGAGGTGGGGGGAAGGGGG - Intergenic
919770256 1:201154105-201154127 GAGTTGGGCGGGAGGGAAGCAGG - Exonic
919780170 1:201216345-201216367 GGATGGGGGTGGGGGGGAGTCGG + Intronic
919780177 1:201216361-201216383 GAGTCGGGGTGGCGGGGAGTTGG + Intronic
919980213 1:202638242-202638264 GGGAGGGGCTGGGGGGGAGGAGG - Intronic
920018187 1:202930691-202930713 CAGTGGGGGTTGGGGGAAGGTGG - Intergenic
920266695 1:204729469-204729491 GAATGGAGTTGGGGTGAAGTTGG - Intergenic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
920487106 1:206381210-206381232 GAGTGGGGGATGGGGGAAGAAGG - Intronic
920556705 1:206909588-206909610 GAGTGGGGCGGGGGTGGAGCTGG - Intronic
920656921 1:207884036-207884058 GAGTGGGGGTGGGGAGAGGCAGG - Intergenic
920920606 1:210294547-210294569 GAGTGAGGGTGGGGGGAAGGAGG + Intergenic
921123826 1:212159441-212159463 GAGAGGGGTTGGGGCCAAGTGGG + Intergenic
921172545 1:212562174-212562196 GATTGGGGTTGGGGAGAGGTGGG - Intergenic
921320278 1:213931902-213931924 GAGAGGGACTGGGGGAAACTGGG - Intergenic
921423356 1:214974226-214974248 GAGAGGGGTTGGGGGCAAGGAGG - Intergenic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
921814677 1:219550160-219550182 TAGGGGAGCTGGGGGGAAGGTGG - Intergenic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
922065986 1:222143760-222143782 TAGTGGGGGAGAGGGGAAGTGGG + Intergenic
922188437 1:223296370-223296392 GAGTGGGCCTAGGGAGAAGGGGG + Intronic
922223584 1:223626941-223626963 GGGTGGCGGTGGGGGGAGGTGGG + Intronic
922559932 1:226562005-226562027 GGGTGAGGTTGGGGGGAAGTGGG + Intronic
922675819 1:227548191-227548213 CAGTTGGGCTGTGAGGAAGTGGG + Intergenic
922705528 1:227788348-227788370 TAGTGGGGCTGGGACGAAGTGGG + Intergenic
922707343 1:227796389-227796411 GAGTGGGCCTGGGGGTTAGCAGG - Intergenic
922794943 1:228335301-228335323 GAGTGGGGGTGGGGGGATGGGGG + Intronic
923015038 1:230120161-230120183 GGGTGGGGGTGGGGGTGAGTGGG + Intronic
923090611 1:230737886-230737908 GGCTGGGGATGGGGTGAAGTGGG - Intergenic
923108145 1:230869430-230869452 GAGAGGGGCTTGGGGGAAGTGGG - Intronic
923303241 1:232663030-232663052 GTGTGGGGCTCAGGGGAAGCAGG + Intergenic
923415740 1:233757930-233757952 GAGTGGAGGTGAGGGGCAGTGGG - Intergenic
923493775 1:234507342-234507364 GGGTGGGGCGGGGGGGGGGTGGG - Intergenic
923652923 1:235890493-235890515 CAGAGGGGCAGGGGGTAAGTGGG - Intergenic
923723499 1:236487060-236487082 AAGTGGGCCTGGGTGGAAATGGG - Intergenic
924706407 1:246506644-246506666 GCGTGGGGCTGGGTGGGAGCTGG - Intronic
924741209 1:246795123-246795145 GAGTGGGGTGGGGTGGAAGCCGG + Intergenic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062771240 10:103284-103306 GCGTGGGGCTGGGGGTGAGGGGG - Intergenic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062945952 10:1462150-1462172 GCCTGGGGGTGGTGGGAAGTGGG - Intronic
1063282198 10:4642435-4642457 TAGTGGGGTTGGGGGGTAGATGG + Intergenic
1063371713 10:5526595-5526617 GTGAGGGGTTGGGGGGCAGTTGG + Exonic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1063599410 10:7466705-7466727 GAATGGGGCTTGGGGGAAGACGG - Intergenic
1063614986 10:7593409-7593431 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615005 10:7593475-7593497 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615024 10:7593541-7593563 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615034 10:7593574-7593596 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615044 10:7593607-7593629 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615054 10:7593640-7593662 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615064 10:7593673-7593695 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063615073 10:7593706-7593728 GAGTGGGGCTGGGTGGCTGCAGG - Intronic
1063869121 10:10399383-10399405 GAGTGGGGTGGCGGGGAGGTAGG - Intergenic
1064250695 10:13704419-13704441 GGGTCTGGCTGGAGGGAAGTGGG - Intronic
1064452232 10:15452975-15452997 GAATGGGGCTGGGGGAGGGTGGG + Intergenic
1064865330 10:19872672-19872694 GGGTGGGGCTCAGGGGAACTGGG + Intronic
1065555534 10:26912032-26912054 GAGTGGGGCTCAGTGGAATTAGG - Intergenic
1066323355 10:34327847-34327869 AAGTGGGCCTCAGGGGAAGTGGG - Intronic
1066427824 10:35324948-35324970 GAGTGGGACTGAGGGGATGATGG - Intronic
1066994794 10:42553594-42553616 GAAGGGGGCTGGTGGGAAGGAGG + Intergenic
1067092620 10:43276630-43276652 GGGTGGGGCTGGGGAGATGTTGG - Intergenic
1067156968 10:43790347-43790369 GAGTCGGGCTGGGGGCAACCAGG + Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067560173 10:47300034-47300056 GAGGGGGGCTGGGCGGCAGTTGG - Intergenic
1067702051 10:48580746-48580768 GAGTGAGCCTGAGGGGCAGTTGG + Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1067838487 10:49656685-49656707 CAGTGGGGCAGGGGAGATGTTGG + Intronic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1068397455 10:56482301-56482323 GAGTTGGGGATGGGGGAAGTAGG + Intergenic
1068876267 10:61999934-61999956 AAGTGGGGCTGGGAGGATGCTGG + Intronic
1068969174 10:62945285-62945307 GAGTGGGGGTGGGGGAGAGGAGG - Intergenic
1069136501 10:64773145-64773167 GGGTGGGGCGGGGGGAAAGGTGG - Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069621659 10:69841060-69841082 AAGTGGGGCAGGGGGGCAGTGGG - Intronic
1069633629 10:69912540-69912562 GGGTGGGGGTGGGGGGCGGTCGG - Intronic
1069840146 10:71334751-71334773 GAATGGGGATGGGGGGAGGCTGG - Intronic
1069994991 10:72336503-72336525 GAGTGAGTGTGGGGGGAAGGCGG - Exonic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070311076 10:75274384-75274406 TGCTGGGGCTGGGGGGAAGGAGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070741247 10:78904556-78904578 GAGTGGGGCTGGGTGGGCATAGG - Intergenic
1070814042 10:79312248-79312270 GAGGTGGGCTGGTGGGAAGGCGG - Intronic
1071178536 10:82955998-82956020 GAATTGGGCTGGGGAGAAGTTGG - Intronic
1071304539 10:84286833-84286855 GAGTAGGGGTGGGAGGAAGGTGG + Intergenic
1071502329 10:86212651-86212673 GAGGGTGGCTGGGGGCAGGTGGG - Intronic
1071572888 10:86707792-86707814 GAGTTGGGCTGGGGAAAGGTTGG - Intronic
1071574537 10:86715989-86716011 GAGTGGGGGTGGGGGTACCTGGG - Intronic
1072018889 10:91379388-91379410 GTGGGGGGTTGGGGGGCAGTGGG - Intergenic
1072069776 10:91905290-91905312 GGGGGCGGCGGGGGGGAAGTGGG - Intergenic
1072271735 10:93783506-93783528 CAGTGGGGCTGTGGGGAGGGAGG + Intronic
1072343837 10:94482784-94482806 TAGTGGGGCAGGGAGAAAGTGGG - Intronic
1072394475 10:95024685-95024707 GAGTGGGGGGAGGGGGAAGGGGG + Intergenic
1072407507 10:95168768-95168790 GAGTGGGGCAGGGGAGCAGGAGG + Intergenic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072625368 10:97107849-97107871 GAGTGTGGTTGGTGGGCAGTGGG - Intronic
1072719061 10:97769762-97769784 GGGTGGGGTTGGGGGACAGTTGG + Intronic
1072806698 10:98428016-98428038 GAGAGGGACTGGGAGGAAGATGG + Intronic
1072810592 10:98458382-98458404 GAGTTGGGCAGGTGTGAAGTGGG - Intronic
1073900019 10:108209389-108209411 TAGGGGGATTGGGGGGAAGTTGG - Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1074958107 10:118412286-118412308 GAATGGGGCTGGGGAGGAGTGGG + Intergenic
1075079106 10:119370962-119370984 GAGTGGGGCGGGGGGGTGGAAGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075864596 10:125706768-125706790 GAGTGGGGTTGGGGGGATCGAGG - Intergenic
1076289398 10:129332694-129332716 AATTGGGGGTGGGGGGAAGAGGG + Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076402470 10:130193061-130193083 GAGTGGGGCTTTGGAGAAGCAGG - Intergenic
1076456325 10:130601157-130601179 TAGTGGGGCTTGGGGGCAGGTGG - Intergenic
1076568175 10:131412941-131412963 GTGTGGGGCCGGGGGAAAGGCGG + Intergenic
1076736481 10:132461395-132461417 GAGAGGGGCTGGGGGCAACAAGG - Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076903172 10:133349889-133349911 GAGGGGGGCTGGAGGCAGGTGGG + Intronic
1077050273 11:563322-563344 GAGTGGTTCTGGGGGGAGGCTGG + Intronic
1077107246 11:847608-847630 GAGCGGGGTTGGGGGGGGGTGGG - Intronic
1077113102 11:870534-870556 GGGTGGGGCTGTGGGGGAGCTGG - Intronic
1077333954 11:1995090-1995112 GAGGGGGGCTGGGGGGCATGGGG - Intergenic
1077545397 11:3167033-3167055 GGGTGGGGCTGGGGTGGAGCAGG + Intergenic
1077609565 11:3636022-3636044 GCCTGGGGGTGGGGGGAAATGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1077914995 11:6605652-6605674 GAGTGGGGCGGGTAGGAAGAGGG - Intronic
1078059334 11:8033181-8033203 GCTTGGGGCTTGGAGGAAGTGGG - Intronic
1078091394 11:8266705-8266727 GAGTGGGGGTGGGAGATAGTGGG + Intronic
1078317404 11:10304906-10304928 GAGTTGGGATGGGGGGAGGGGGG - Intronic
1078432552 11:11298955-11298977 GAGTGGGGCCTGGTGGAGGTTGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1079244896 11:18744723-18744745 GAGAGGGGCTGGGGGCAGTTAGG + Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079885308 11:25981071-25981093 GGGTGGAGGTGGGGGGAAGCAGG + Intergenic
1079885987 11:25989540-25989562 GTTTTGGGGTGGGGGGAAGTGGG + Intergenic
1080165100 11:29226330-29226352 GACTGGGGGTGGGGGGTGGTGGG + Intergenic
1080419991 11:32101235-32101257 GGGTTGGGCTGGGGGGGATTTGG - Intronic
1080615302 11:33940475-33940497 GAATGGGGCTGGGCTGAAGCAGG - Intergenic
1081012690 11:37834994-37835016 GAGTGAGGAAGGAGGGAAGTGGG - Intergenic
1081312597 11:41592206-41592228 GAGTTCAGCTGGGGGGAGGTTGG - Intergenic
1081539290 11:44018377-44018399 GAGTGGGGCTGGGGCGAGTTGGG - Intergenic
1081656664 11:44862007-44862029 GAGTGGAGGTGGGGGGAAAAAGG - Intronic
1082557595 11:54581457-54581479 GGGTGGGGGTGGGGGGAGGGGGG - Intergenic
1082774931 11:57237483-57237505 GATAGGGGCTGGGGTGAAGGTGG - Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082802516 11:57425339-57425361 AAGTGGGGCTGTGGTGAAGTGGG + Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083192376 11:61061592-61061614 GGGTGGGGCGGGAGGGAGGTGGG - Intergenic
1083311050 11:61783928-61783950 GAGTGCCGGTGTGGGGAAGTGGG + Intronic
1083317905 11:61827817-61827839 GAGTGGGGGAGGGAGGAGGTCGG + Exonic
1083338855 11:61945731-61945753 GGGTGGGGGTGGGTGGAAGGTGG + Intergenic
1083593050 11:63906473-63906495 GAGTGGGGGTGGGGTGGGGTGGG - Intronic
1083597874 11:63927821-63927843 GAGAGGGGCTGGGGGCAGTTAGG - Intergenic
1083614032 11:64017779-64017801 GAGAGGTGATGGGGGGAGGTGGG - Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1083897085 11:65625349-65625371 GACTGGGGCCGGGGGGAAGGAGG + Intronic
1083909563 11:65698169-65698191 GAGTGAGGGAGGGTGGAAGTCGG - Intergenic
1083997182 11:66278337-66278359 CCGTGGGGCTCGGGGGACGTGGG - Exonic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084089370 11:66870173-66870195 GACTGGGGATGGGGAGAAGAGGG - Intronic
1084499213 11:69525028-69525050 ATGAGGGGCTGGGGGGAACTGGG + Intergenic
1084570668 11:69957790-69957812 GAGAGTGGCTGGGGGGTGGTAGG + Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084702829 11:70798623-70798645 GAGTGGGGCTGGGCAGAGGCAGG + Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084708776 11:70831093-70831115 GAGTTGGGCTGGGGGCAGGCGGG + Intronic
1084960214 11:72712565-72712587 GAGTGGGTCTCGGGGGCAGGAGG - Exonic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085134683 11:74075367-74075389 GGGGGGGGGTGGGGGGAAGTAGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1085623015 11:78051297-78051319 GGGTGTGACAGGGGGGAAGTTGG + Intronic
1085743569 11:79096488-79096510 GAGTGGGGGTGGGGTGGGGTGGG - Intronic
1086621382 11:88890118-88890140 GGGTGGGGATGTGGGGATGTGGG - Intronic
1086855698 11:91862482-91862504 GTGCAGGGCTGGGGAGAAGTTGG + Intergenic
1087034486 11:93742180-93742202 GTGTGGGGCAGGGGGGATGTAGG - Intronic
1087141903 11:94772363-94772385 GAGTGAGGATGGGGAGAAGAGGG - Intronic
1087479327 11:98679988-98680010 GGGTGGGGGAGGGGGGTAGTGGG + Intergenic
1087513027 11:99122128-99122150 AAGTGGAGTTGGGGGGAGGTTGG - Intronic
1087772499 11:102225920-102225942 GAGTGGGGCCTGTAGGAAGTGGG + Intronic
1087935947 11:104035056-104035078 AAGTGGGGGTGGGGGAGAGTAGG + Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088472218 11:110198679-110198701 GAGTGGGGTTGGGGGGTGGAGGG - Intronic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1089012125 11:115139943-115139965 GACTGGGGCTGGGGTGGAGGTGG + Intergenic
1089098486 11:115939716-115939738 GAGAGGGGAGGAGGGGAAGTGGG + Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089348413 11:117807070-117807092 GCGTGTGGCTTGGGGGAAGCGGG - Intronic
1089396745 11:118141096-118141118 GAATGGGAATGGGGGGAAGGAGG + Intronic
1089534836 11:119154578-119154600 GAGTGGGGAAGGGAGGCAGTGGG + Intronic
1089792175 11:120953227-120953249 GTGGGGGTCTGGGGAGAAGTGGG - Intronic
1090007716 11:123017576-123017598 GCGCGGGGCTGGCGGGCAGTTGG + Intergenic
1090988596 11:131795778-131795800 GACTGGGGTTGGGGGGTGGTGGG + Intronic
1091135053 11:133180854-133180876 AAGTGGGGATGAGGGAAAGTAGG + Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091335828 11:134764977-134764999 AAGAGGGGCTGTGGTGAAGTGGG - Intergenic
1202816937 11_KI270721v1_random:50272-50294 GAGGGGGGCTGGGGGGCATGGGG - Intergenic
1091402278 12:188434-188456 GAGAGGCGCTGGCGGGAAGCGGG - Intergenic
1091407538 12:218694-218716 GGGTGGGGATGGGGGGGTGTAGG - Intergenic
1091493131 12:949917-949939 GAGGGAAGCTGGCGGGAAGTAGG - Intronic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091569180 12:1669626-1669648 GAATGGGAATGGGGAGAAGTAGG + Intergenic
1091804281 12:3344722-3344744 GAATGGTGGTGGGGGGAAGTGGG + Intergenic
1091958097 12:4665248-4665270 GCCAGGGGCTGGGGGGAAGGAGG - Intronic
1091965310 12:4735746-4735768 GACGTGGGCTGGGGGGAAGGAGG - Intronic
1092075011 12:5665703-5665725 GGGTGGGGGTGGGGGGTGGTGGG - Intronic
1092096637 12:5848352-5848374 AACTGGGGAGGGGGGGAAGTAGG - Intronic
1092193532 12:6535990-6536012 GACTGGGGCGGGTGGGAAGAGGG - Intronic
1092219083 12:6700660-6700682 GAGCGGGGCTGGGGGGTCGCAGG + Intronic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1092793104 12:12086414-12086436 GAGTGGGGAAGAGGGGAGGTGGG - Intronic
1092916698 12:13195952-13195974 GAGTGGTGCAGGGAGGTAGTAGG + Intergenic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093809254 12:23472523-23472545 GCCTGGGGCTGGAGTGAAGTGGG - Intergenic
1093893479 12:24551179-24551201 GTTTGGGGCTGGGGGGAGATGGG - Intergenic
1094086004 12:26592261-26592283 TAGTGGGGCAGAGGGGAAGTGGG + Intronic
1094492882 12:30972208-30972230 GAGTGGAGCTGGAGGTCAGTGGG + Intronic
1094713608 12:32989127-32989149 GAGAGGGGCTGAGGGTATGTGGG + Intergenic
1094817905 12:34205040-34205062 GAGTGGGGCGGGGGGCAGGGGGG - Intergenic
1095172347 12:39050703-39050725 GATGGAGGCTGGGTGGAAGTGGG - Intergenic
1095975656 12:47939368-47939390 GGGTGGGGCTTGGGGGAGGTGGG - Intronic
1096188171 12:49597460-49597482 GGGTGGGGGTGGGAGGAAATGGG + Intronic
1096415487 12:51408682-51408704 GAGTATGGCTGAGGGGAACTGGG + Intronic
1096651009 12:53061960-53061982 GAGTGGGGTGGGGATGAAGTTGG + Intronic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1097226164 12:57477901-57477923 GGGTGGGGGAGGCGGGAAGTTGG - Intronic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1097966352 12:65585659-65585681 GAGTGGAGCTGGAGGAAAGGAGG - Intergenic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098534534 12:71579769-71579791 GGGTGGACTTGGGGGGAAGTGGG - Intronic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098929746 12:76397346-76397368 GAGGGGGGGTGGGGGCAGGTGGG + Intronic
1099165955 12:79307618-79307640 GGGTGGGGGTGGGGGGGCGTGGG + Intronic
1100168677 12:91947652-91947674 TTGAGGGGCTGGGAGGAAGTAGG + Intergenic
1100198368 12:92272575-92272597 GAGTTGGGCAGGGGGGCCGTGGG + Intergenic
1100671541 12:96818653-96818675 GAGTGGGGCAGAAGGGAAATGGG - Intronic
1101331550 12:103761573-103761595 GAGTGGGGATGGCAGGAAGCAGG - Intronic
1101612114 12:106302287-106302309 GAGCGGGGCTCTGGGGAGGTGGG - Intronic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102516035 12:113447391-113447413 GATTGGGGGTGGGGGGGAGGTGG + Intergenic
1102817323 12:115877615-115877637 GAGTGGGGTTGGGGGCCAATGGG + Intergenic
1103039277 12:117681521-117681543 GAGAGGGGCAGAGGTGAAGTCGG + Intronic
1103154016 12:118667805-118667827 GGGTGGGGGTGGGGTGAGGTGGG + Intergenic
1103216803 12:119208010-119208032 GAATGGGGGTTGGGGGAAGAGGG - Intronic
1103229685 12:119318759-119318781 GGGTGGAGCTGGGTGGAGGTGGG + Intergenic
1103238949 12:119397864-119397886 AAGTGGGGCAGGGAGGAAGGGGG + Intronic
1103940668 12:124499684-124499706 GAGTGAATATGGGGGGAAGTGGG + Intronic
1103948663 12:124540506-124540528 GAGTGGAGATGGGGGGATGGGGG + Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1103985987 12:124767774-124767796 AGGTGGGGCTGGGAGCAAGTAGG - Intergenic
1104259277 12:127167669-127167691 GAGTGGGGCAGAGAGAAAGTAGG - Intergenic
1104405909 12:128516462-128516484 GATTGGGGCTGGGAGGGACTGGG + Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104460571 12:128952425-128952447 GGGTGGGGGTGGGGGGGGGTGGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104605124 12:130182637-130182659 GAGGGGGGCTGGGTGGAGCTTGG - Intergenic
1104624613 12:130340637-130340659 GAGGGGGGGTGGGGGGAGGGGGG + Intronic
1104715073 12:131011089-131011111 GGGTGGGGCAGGGGTGAGGTGGG - Intronic
1104715109 12:131011167-131011189 GGGTGGGGCAGGGGTGAGGTGGG - Intronic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1104971012 12:132530717-132530739 GGGTGGGGCTGGGGGGTGGGGGG + Intronic
1104982554 12:132580736-132580758 GATTAGGGCTGGGAGGGAGTCGG + Intronic
1105253253 13:18720383-18720405 GTGTCGGGCTGGGGGACAGTCGG - Intergenic
1105322481 13:19341029-19341051 GATTGGGGGAGGGTGGAAGTGGG + Intergenic
1105875191 13:24546107-24546129 GATTGGGGGAGGGTGGAAGTGGG - Intergenic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106473969 13:30081533-30081555 GGGTGGGGTTGGGGGGAAGGTGG - Intergenic
1107651410 13:42549028-42549050 AAGTGGGGCTGGGGGAAACAGGG - Intergenic
1108007225 13:45961540-45961562 TAGTGGGGGTGGGGAGATGTGGG + Intronic
1108364150 13:49693137-49693159 GGGTGGGGCGGGGCGGGAGTGGG + Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1109143370 13:58745306-58745328 CAGTGAGGGTGGGGGAAAGTAGG + Intergenic
1109737765 13:66509120-66509142 TAGTTGGGCTGAGGGGAAGTTGG - Intronic
1109757663 13:66782117-66782139 GAGTGGGGCTGGGAGGAAAGAGG - Intronic
1110002673 13:70224623-70224645 GAGTGGGGCAGAAGGGAAGGAGG + Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111266988 13:85829143-85829165 CAGTGAGGCTGGGGAGATGTTGG + Intergenic
1111682977 13:91466722-91466744 GAGTGGGACTGGGGAGAGGGAGG + Intronic
1111721433 13:91950351-91950373 GGGTGGGGCTGGGAGGGAGGAGG - Intronic
1112266181 13:97925849-97925871 GGGTGGGGGGTGGGGGAAGTTGG - Intergenic
1112461100 13:99604543-99604565 GAGTGGGGCTGGAGATAAATTGG + Intergenic
1112551789 13:100428327-100428349 GGGTGGGGGTGGGGGGTAGGGGG - Intronic
1113425749 13:110207106-110207128 GAGCTGGGCTGGGGGGCAGGAGG - Intronic
1113545152 13:111143013-111143035 GTGTGGAGCTGGGTGGCAGTAGG + Intronic
1113754809 13:112803909-112803931 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754864 13:112804070-112804092 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754884 13:112804123-112804145 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754920 13:112804219-112804241 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754937 13:112804262-112804284 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754960 13:112804323-112804345 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113754980 13:112804375-112804397 GAGAGGGGATGGGGGGAGGGAGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113881046 13:113626514-113626536 GAGGGGGGCTGCGGGGAAGCGGG - Intronic
1113899611 13:113788889-113788911 GAGTGGGGCAGGAGGGAGGGAGG - Intronic
1113949507 13:114064279-114064301 GGGTGGGGCTGGGAGGACATGGG - Intronic
1114480986 14:23034467-23034489 CGGTGGGGCCGGGGGTAAGTCGG - Intronic
1114547313 14:23512520-23512542 GGGTGGGGGTGGGGTGAGGTGGG - Intergenic
1114563960 14:23614546-23614568 GACAGGGGATGGTGGGAAGTGGG + Intergenic
1114703756 14:24705421-24705443 GGGTGGGGGTGGGGAGCAGTGGG + Intergenic
1115262562 14:31469024-31469046 AAGTGGGGCTTGGGGGAATCTGG + Intergenic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115431898 14:33329210-33329232 GGGTGGGGCTGGGGGCAGGGTGG - Intronic
1115437797 14:33396004-33396026 GGGTGGGGCTGGAGGGAATGGGG - Intronic
1115488288 14:33934177-33934199 GAATGGGGATGGTGGGAGGTGGG - Intronic
1115500695 14:34046929-34046951 GAATGGGCCTGGGAGGAGGTAGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115904296 14:38189800-38189822 GATTGGGGCAAGGGAGAAGTTGG - Intergenic
1116658066 14:47675356-47675378 GAGTGGGGCTAGGGGAACGGGGG + Intergenic
1116803005 14:49463280-49463302 GAGTGAGGTGGGGGAGAAGTGGG - Intergenic
1117091817 14:52258714-52258736 GAGTGGGGGTGGGGGGCAATTGG + Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1118097390 14:62552637-62552659 GGGGGGGACGGGGGGGAAGTGGG + Intergenic
1118157435 14:63255562-63255584 GGGTAAGGCTGGGGGGAGGTGGG - Intronic
1118245113 14:64102786-64102808 GAGAGGGCCTGGGGAGATGTTGG - Intronic
1119182417 14:72613966-72613988 GAGTGGGGCAGGGGGAAGGAGGG - Intergenic
1119248300 14:73131598-73131620 GAGTGGGTCTGGGAAGGAGTCGG + Intergenic
1119385831 14:74257717-74257739 CGGCGGGGCTCGGGGGAAGTGGG - Intronic
1119416899 14:74477014-74477036 GAATGGGGCTGGGGGGAGACAGG - Intronic
1119416911 14:74477093-74477115 GAATGGGGCTGGGGGGAGACAGG - Intronic
1119484212 14:74977700-74977722 GGGTGCGGCTGCGGGGAGGTGGG + Intergenic
1119485408 14:74983691-74983713 GCCAGGGGCTGGGGGGAGGTGGG + Intergenic
1119578849 14:75755980-75756002 GGGTGGGGGTGGGGGGCGGTGGG - Intronic
1119974589 14:79011370-79011392 GAGGTGGGTTGGGGGGAGGTGGG - Intronic
1119974597 14:79011385-79011407 GGGTGGGGTTGGGGGGAGGTGGG - Intronic
1120017537 14:79490675-79490697 AAGTGGGGGTTGGGGGAGGTGGG + Intronic
1120021586 14:79537092-79537114 TAGTGAGGCTGTGGAGAAGTAGG - Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1121052688 14:90829860-90829882 GAGTGGGGCTGGGGTGCACTTGG + Intergenic
1121172016 14:91862510-91862532 GAGTGGGGCTGAGGGAAATCTGG + Intronic
1121568687 14:94930334-94930356 GACTGGGGGTAGGGGGAGGTGGG - Intergenic
1121661149 14:95636029-95636051 GAGTGGGGCTGGGTGGGACAGGG + Intergenic
1121710586 14:96035975-96035997 GGGTGGGGCAGGGAGGAAGTAGG + Intergenic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1121791508 14:96702880-96702902 GAGTGGGGGCGGGGTGAAGGGGG + Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122413482 14:101537711-101537733 GAGTGGGGCTGGGGTGTGGTGGG + Intergenic
1122556637 14:102584072-102584094 GGGTGGGGGTGGGGGGTGGTGGG + Intergenic
1122652338 14:103232552-103232574 GAGTGGGGCTGGGCAGCAGAAGG + Intergenic
1122652347 14:103232573-103232595 GGGTGGGGCTGGGAGGCAGGAGG + Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122889178 14:104724662-104724684 GAGTAGGGGTGGGTGGAAGGAGG - Intronic
1122905458 14:104799766-104799788 GAGTGGGGGTAGGGAGGAGTGGG - Intergenic
1123106589 14:105844653-105844675 GACTGGGGCTGGCTGGCAGTAGG + Intergenic
1124139364 15:27063883-27063905 GAGAAGGGGTGTGGGGAAGTGGG - Intronic
1124216636 15:27812938-27812960 TAGTGGGCATGTGGGGAAGTGGG - Intronic
1124404294 15:29380053-29380075 GCAAGGGGCTGGGGGGAGGTGGG + Intronic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1125408765 15:39382983-39383005 GAGTGGGGAAGGGGAGAAGGGGG + Intergenic
1125493045 15:40162721-40162743 GAGCAGGTCTGGGAGGAAGTGGG + Intronic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125721934 15:41849374-41849396 GAGTGGGGATTGGGGAAAGCAGG + Intronic
1125954033 15:43777037-43777059 GGGTGGCGCTGGCGGGAGGTGGG - Exonic
1126216723 15:46163924-46163946 GTGAGGGGCAGGGGAGAAGTGGG + Intergenic
1126310667 15:47313025-47313047 GTGTGGGGCTGGGGGTACATGGG - Intronic
1126333686 15:47563480-47563502 GATTGGAGATGGGGGGAGGTAGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126613039 15:50549093-50549115 GAGTGGGGTGGGGGGGAATGGGG - Intergenic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1126953173 15:53905611-53905633 GACTGGGGGTTGGGGGAAGTGGG + Intergenic
1127236616 15:57059732-57059754 GTGGGGGGCTGGGGGGAGGGTGG + Intronic
1127254933 15:57281895-57281917 GCGGGGGGCTGGGGGGAAGGGGG - Intronic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127711102 15:61598946-61598968 GAGAAGGGGTGGGGGGAAGACGG + Intergenic
1127855741 15:62952279-62952301 GTGGGGGGGTGGGGGGAAATTGG + Intergenic
1128119424 15:65134682-65134704 GAGGGGGGGTGGGGGGTAGCGGG - Intergenic
1128451332 15:67807449-67807471 GGGTGGGGCTGGGGTGGAGAAGG - Intergenic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1128682605 15:69662610-69662632 GAGAGGGGCTGGGCAGAGGTGGG + Intergenic
1128701949 15:69811135-69811157 GAAGGGGCCTGGAGGGAAGTGGG - Intergenic
1129296797 15:74604256-74604278 GGGTGGGGCAGGGGTGAGGTGGG + Intronic
1129319406 15:74765954-74765976 GCCTGGGGCTGGGGAGAAGGGGG + Intergenic
1129539054 15:76336569-76336591 GAGATTGGCTGGGAGGAAGTGGG - Intergenic
1129645847 15:77431783-77431805 GGGTGGGGCTGGGAAGATGTTGG - Intronic
1129684166 15:77675872-77675894 GAGTGGGGATGGGGGTAACAGGG - Intronic
1129741764 15:77992819-77992841 GAGTGGAGTGGGGGGGGAGTGGG - Intronic
1129917431 15:79286227-79286249 GAGTGGGGGTGGGGGGTTGGCGG + Intergenic
1130012307 15:80161133-80161155 GAGAGGGGCTGGGAGGAGGCAGG - Intronic
1130575611 15:85090683-85090705 GGGTGGGGGTGGGGGGATGATGG - Intronic
1130718233 15:86358181-86358203 GAGTAGAGCTTGGGGGAAATGGG - Intronic
1130915823 15:88303746-88303768 GAGAGAGGCTGGGGGGAGGAAGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130961192 15:88659640-88659662 GGATGGGGCTGGGGGACAGTGGG - Intergenic
1131061842 15:89409359-89409381 GACTGGGGCTGGGAGGAGCTGGG - Intergenic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1131360123 15:91783405-91783427 GAGTGAGGCTGGGAGAAACTTGG + Intergenic
1131463720 15:92637983-92638005 GGGTGGTGCTGGGGGCCAGTGGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132344040 15:101096852-101096874 GAGGGAGGATGGGGAGAAGTTGG + Intergenic
1132469635 16:94822-94844 GAGCAGAGCTGGGGGAAAGTGGG - Intronic
1132895594 16:2228017-2228039 GAGAGGGGCTGGGAGGCAGAGGG - Intronic
1133335825 16:5006123-5006145 GAGTGGGGCTGGGAGGTGGAGGG + Intronic
1133537070 16:6712708-6712730 GAGGGGAGGTGGGGAGAAGTGGG - Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134079666 16:11316095-11316117 GAGTGAGGCAGTGGGGCAGTAGG - Intronic
1134107427 16:11494317-11494339 GAGTGGGGGTGGGGTGAAGGGGG - Intronic
1134879019 16:17728108-17728130 GAGAGGGGCTGGGACGATGTAGG - Intergenic
1134915530 16:18067580-18067602 TCGAGGGTCTGGGGGGAAGTGGG + Intergenic
1135275832 16:21111852-21111874 GGGTTAGGCTGGGGGCAAGTGGG - Intronic
1135477747 16:22792428-22792450 GAGTGGGGCAGGAGAGAGGTGGG + Intergenic
1135641975 16:24127621-24127643 GATTGGGGTTGGGGGGTAGTGGG + Intronic
1135896682 16:26411568-26411590 GGGTGGGGATGGGGAGATGTAGG + Intergenic
1136064886 16:27751929-27751951 GACTGGAGCTGGGGGGCTGTGGG + Intronic
1136104319 16:28018678-28018700 GCCTGGGGGTGGGGGGAAGGTGG - Intronic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136265083 16:29111500-29111522 GAGTGGGGCTGGACAGAAGGTGG + Intergenic
1136765442 16:32772729-32772751 GAGGTGGGCGGGGGGGAGGTGGG + Intergenic
1136802657 16:33097650-33097672 GAGGTGGGCGGGGGGGAGGTGGG - Intergenic
1137463993 16:48691435-48691457 GGGTGGTGGTGGGGGGAAGCAGG + Intergenic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1137872908 16:51967773-51967795 GGGAGGGGCTGGGGGGCAGGAGG - Intergenic
1138348668 16:56335072-56335094 GAGTGGGGCTGTGAGGAACAGGG + Intronic
1138497309 16:57416321-57416343 GAGCTGGGCTGGGGGGAAACCGG - Intergenic
1138505943 16:57478357-57478379 GAGTGGGGTTGGGGGGCATGCGG - Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138649550 16:58451547-58451569 GAGTGGGGCTGGCAGGGGGTTGG + Intergenic
1139456734 16:67085498-67085520 GGGTGGGGGTGGGGGGAGATGGG + Intronic
1139480403 16:67227358-67227380 GAGCTGGGCTGGGGGGATGGCGG + Intronic
1139543910 16:67639825-67639847 GAAAGGGGCTGAGGGGAAGCTGG + Intergenic
1139613950 16:68077891-68077913 TGGTGGGGGTGGGGGGGAGTGGG - Intronic
1141461937 16:84182960-84182982 GCATGGAGCAGGGGGGAAGTGGG + Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141599292 16:85115500-85115522 AATGGGGGCTGGGGCGAAGTTGG + Intergenic
1141672236 16:85498121-85498143 GAGTGGAGCTGGCGGGAGGAGGG + Intergenic
1141684827 16:85564240-85564262 GAGTGAGGCTGGGAGGAAGGAGG + Intergenic
1141700526 16:85640117-85640139 GGGTGGTGCTGGGGTGAGGTGGG - Intronic
1142140990 16:88472818-88472840 GAGTGGGGCTGGGGCAAGGGTGG - Intronic
1142206669 16:88786028-88786050 GAGTGGGGCTGGGGGGACTGTGG + Intergenic
1142387986 16:89778955-89778977 GAGCAGGGCGGGGAGGAAGTGGG + Exonic
1142668702 17:1477480-1477502 GAGTGGGGCTGCGGGGCTGCTGG - Intronic
1142779754 17:2172305-2172327 GAGGGGGGCGGGGAGGAAGGGGG + Intronic
1142848675 17:2694090-2694112 AGGTGGGGCTGGGTGGAGGTGGG - Intronic
1143022897 17:3925869-3925891 GACTGGGGCTGGGGGCAGGGCGG - Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143107897 17:4538531-4538553 GGTTGGGGCTGGTGTGAAGTTGG - Exonic
1143282484 17:5765251-5765273 GAGTGGGGCTGGGAGTCAGGTGG - Intergenic
1143471117 17:7176928-7176950 GGCTGGGGCTGGGGGGCTGTCGG - Intronic
1143474921 17:7196956-7196978 GAGTAGCGCCGAGGGGAAGTGGG + Exonic
1143592023 17:7890911-7890933 GAGAGGGGCTTTGGTGAAGTAGG - Intronic
1144011249 17:11150396-11150418 AAGTGGGGCTGGGGGGAGTGGGG - Intergenic
1144465827 17:15496442-15496464 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1144620889 17:16817933-16817955 GAGTGGGGATGGGGAGAAAGTGG - Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144750434 17:17644613-17644635 ATGTGGGGCAGGGAGGAAGTGGG + Intergenic
1144754226 17:17669692-17669714 GAGTGGGGATGGGGGTGAATGGG - Intergenic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1144797099 17:17899457-17899479 GAGTGGAGCTGTTTGGAAGTTGG + Intronic
1144962301 17:19051720-19051742 GAGTGGGGCTGGGTGCAAGAAGG - Intergenic
1144972860 17:19122800-19122822 GAGTGGGGCTGGGTGCAAGAAGG + Intergenic
1145055885 17:19703839-19703861 GAGTGGGGATGGGGAGAAAGTGG + Intronic
1145118691 17:20236054-20236076 GAGAGGGGAGGGGCGGAAGTTGG + Intronic
1146056283 17:29582900-29582922 GAGTGGGGCTGGAGGGGTGGTGG - Intronic
1146266114 17:31453990-31454012 GGGTGGGGCTGGGGGGGATGCGG - Intronic
1146460373 17:33041534-33041556 GTCTGGGGCTGGGAGAAAGTAGG - Intronic
1146527951 17:33582983-33583005 GAGTGGGGCTGGGTGGGGTTGGG + Intronic
1146726543 17:35161059-35161081 GAATGAGGCAGGGAGGAAGTGGG - Intronic
1146792611 17:35760957-35760979 GAGTGGGGCTGGAGGCAGGGTGG + Intronic
1147387048 17:40088988-40089010 GAGAGGGGCAGGGGGGTACTGGG - Intronic
1147422975 17:40331793-40331815 GAGTGGGGGTGGGGCGTAGGTGG - Intronic
1147572865 17:41582229-41582251 GAGTGGGGGTGGGGAGAAAGTGG - Intergenic
1147587546 17:41661032-41661054 GAGTGGGGGTGGGGGGTGGGGGG - Intergenic
1147783819 17:42963690-42963712 TAGTGGTGCTGGGGGGCAGAGGG - Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147846439 17:43407235-43407257 GAGTGGGGAGGTGGGGAGGTGGG + Intergenic
1147909580 17:43847391-43847413 GGCTGGGGGTGGGGGGAGGTGGG + Intronic
1148082734 17:44976542-44976564 GAGTGGGGCTGGGGGCTGGTGGG - Intergenic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148705206 17:49624142-49624164 GAGTGGGACTGGGGAGATGTAGG + Intronic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149250327 17:54760839-54760861 GAGTGGGGACTGGGAGAAGTGGG - Intergenic
1149428492 17:56577968-56577990 GAGGGGGGCTGGGCAGAGGTTGG + Intergenic
1149492275 17:57093759-57093781 TAATGGGGGTGGGGGGCAGTGGG - Intronic
1149655321 17:58306754-58306776 GAAGGGGGCTGGTGGGAGGTGGG + Intronic
1149838160 17:59932838-59932860 GATTCTGGCTGGGGGGAAGGTGG - Intronic
1150007472 17:61478793-61478815 AAGTGGGGCTGTGGGGCAGTGGG - Intronic
1150561905 17:66302293-66302315 GAGTGGGGATGCGGGGGAGGAGG - Intergenic
1150646106 17:66978464-66978486 GTGTGGGGGAGGGGTGAAGTGGG - Intronic
1150765003 17:67995695-67995717 GTGGAGGGCTGGGGGGAAGCGGG - Intergenic
1150807002 17:68327189-68327211 GAGTGGGGCGTGGGGGAGGGAGG + Intronic
1150895514 17:69205776-69205798 CAGTGGGGCTGGGGGAATATTGG + Intronic
1151522677 17:74641553-74641575 GGGTGGGGCTGGGGTGCACTGGG - Intergenic
1151617598 17:75224484-75224506 GAGAAGGGGTGGGGGGAAGCAGG + Intronic
1151975018 17:77479766-77479788 GAGGGATGCTGGGGGGAGGTGGG + Intronic
1151979078 17:77498406-77498428 GAGTGGGGGTGGGGGCAGGCGGG + Intronic
1151999923 17:77638784-77638806 GGGTGGGGTGGGGGGGAAGCGGG + Intergenic
1152078601 17:78172993-78173015 GAGTGGGGGTGGGGGTACCTGGG + Exonic
1152149527 17:78590270-78590292 GAGTGGCGGTGGGGGGGGGTGGG - Intergenic
1152250179 17:79208390-79208412 GGGTGGGGCTGGGAGTCAGTCGG + Intronic
1152286429 17:79415697-79415719 GGGAGGGGCTGGGGCGGAGTCGG + Intronic
1152624060 17:81380172-81380194 GAGTGGGGGTGGGGAGTAGTGGG - Intergenic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152863310 17:82708842-82708864 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863344 17:82708922-82708944 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863377 17:82709002-82709024 GGGTGGGGCTGGTGGTAAGGGGG - Intergenic
1152863472 17:82709256-82709278 GGGTGGGGCATGGGGGCAGTGGG - Intergenic
1152976965 18:230257-230279 GAGTGGGGGTTGGGGGATGGGGG + Intronic
1152992756 18:377872-377894 GAGTGGGGCTGGGGGAAATAGGG + Intronic
1153006435 18:501546-501568 GAGTGGAGCTGGGGCGAGGGAGG + Intergenic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1154941552 18:21117957-21117979 GAGTGGTGCTGGGTGGGAGGGGG - Intergenic
1155267037 18:24104325-24104347 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1155270965 18:24140671-24140693 GGGTGGGGGAGGGGGAAAGTGGG - Intronic
1155273224 18:24160930-24160952 GAGACTGGCTGGGGGGAAATGGG + Intronic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156003900 18:32417729-32417751 TAGTGGGGGTGGGAGGAAGGTGG + Intronic
1156466929 18:37353634-37353656 AGGTGGGGCTGGGGGAAAGGTGG + Intronic
1156481072 18:37436751-37436773 GGCTGGGGCTAGAGGGAAGTCGG + Intronic
1156911883 18:42420828-42420850 GTGTGGGGGCTGGGGGAAGTGGG - Intergenic
1157279339 18:46335369-46335391 GAGTGGAGGTGGGGAGAAGAGGG - Intronic
1157312966 18:46566190-46566212 GGATGGGGCTGAGGGGAAGGAGG - Intronic
1157335507 18:46734394-46734416 GAGCAGGGGTGGGGGGAGGTGGG - Intronic
1157477787 18:48034504-48034526 GAGGAGGGCTGGGAGGAAGAGGG - Intronic
1157517318 18:48320262-48320284 GAGTGGAGCGAGGGGGAAGTGGG + Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1157759442 18:50249707-50249729 GGGTGGGGCAAGAGGGAAGTAGG + Intronic
1157860130 18:51133726-51133748 GAGTGGGGCCGTGGGGACGGAGG + Intergenic
1158162355 18:54499540-54499562 GAGTAGGGATGGGGGGAATAGGG + Intergenic
1158285122 18:55872053-55872075 GTGGGGGGCTGGGAGGAAGGTGG + Intergenic
1158533817 18:58289275-58289297 GAGAGGGGCTGAGGGGCAGGTGG + Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158856494 18:61547713-61547735 GTGTGGGGCGGGGGTGTAGTGGG - Intronic
1159961285 18:74557529-74557551 GAGTGGGGGTGGGGAGGAGCTGG - Intronic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160176066 18:76595349-76595371 GGATGGGGGTAGGGGGAAGTAGG + Intergenic
1160439708 18:78879854-78879876 GCCAGGGGCTCGGGGGAAGTAGG - Intergenic
1160500964 18:79400875-79400897 GAGGGTGGCTGGGGGGAGGGAGG - Intronic
1160712794 19:560404-560426 GAGGAGGGCTAGGGGGAAGAAGG + Intergenic
1160716386 19:578653-578675 GCCTGGGGCTGGGGGGATGTGGG + Intronic
1160738799 19:676583-676605 GAATGCGGCCGGGGGGACGTCGG + Intronic
1160782274 19:883180-883202 AAGTGGGGATGTGGGGCAGTGGG + Intronic
1160817345 19:1042271-1042293 GCATGGGGCTGGGGGGACGTTGG - Intronic
1160875885 19:1295988-1296010 GTGTGGGGCCAGGGGGGAGTGGG + Intronic
1160875901 19:1296021-1296043 GAATGGGGCCAGGGGGGAGTGGG + Intronic
1160915298 19:1493429-1493451 GGGAGGGGCTGGGGGGACTTGGG + Intronic
1160936775 19:1599786-1599808 GAGTGGAGCTGGGGGGAGGCTGG + Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161345635 19:3767586-3767608 GTGTCGGCCTGGCGGGAAGTGGG + Intronic
1161398534 19:4057820-4057842 GGGTGGAACTGGCGGGAAGTAGG - Intronic
1161638119 19:5401950-5401972 GAGGGAGGCAGGGGGGAAGGAGG + Intergenic
1161924734 19:7292461-7292483 GGGCGGGGCTGGGGGGGGGTGGG + Intronic
1162316183 19:9939582-9939604 GAGGGGAGCAGGGGGAAAGTGGG - Intergenic
1162322162 19:9976878-9976900 CATTCGGGGTGGGGGGAAGTTGG + Intronic
1162638402 19:11987982-11988004 GGGTGGGTCTGGGCGGCAGTCGG + Intergenic
1162937624 19:13989258-13989280 GTGAGGGGATGGGTGGAAGTGGG + Intronic
1163126514 19:15247176-15247198 GAGTGGGGCTGGGGGGTGGGTGG - Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163447794 19:17357744-17357766 GAGAGAGGCCGGGGGCAAGTGGG - Intronic
1163618103 19:18341351-18341373 GTTTGGGGGTGGGGGGGAGTCGG - Intronic
1163871037 19:19821546-19821568 GAGAGGGGCTGGTTGGAACTGGG - Intronic
1164038520 19:21474397-21474419 GAATGGGGCGGGGGGGAGGTGGG - Intronic
1164581304 19:29437041-29437063 GAGTGGGGCTGGAGAGATGGAGG + Intergenic
1164671684 19:30076193-30076215 GAGAGGGGCTGGGGAGGGGTTGG - Intergenic
1164759930 19:30721020-30721042 GCCAGGGGCTGGGGAGAAGTGGG - Intergenic
1164819457 19:31235342-31235364 GGTTGGGGTTGGGGGGAAATGGG - Intergenic
1164995941 19:32720397-32720419 GGGTGGAGCTGGGTGGGAGTGGG - Intronic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165072329 19:33262615-33262637 GAGAGGGGCTGGGGGGTCCTGGG - Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165929512 19:39347471-39347493 GACTGCGGCTGGGGGACAGTGGG - Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166144781 19:40826396-40826418 GGTTGGGGCTGAGGGGGAGTGGG + Intronic
1166148759 19:40855456-40855478 GGGTGGGGCTGTGGGAATGTTGG + Intronic
1166152899 19:40887241-40887263 GGGTGGGGCTGTGGGAATGTTGG + Intronic
1166182961 19:41121811-41121833 GGTTGGGGCTGAGGGGGAGTGGG - Intronic
1166449547 19:42886666-42886688 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166460845 19:42986962-42986984 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166478139 19:43146949-43146971 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166583123 19:43920532-43920554 GGGTGGGGGGGGGGGGCAGTGGG + Intronic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1166855098 19:45779416-45779438 GTGAGGGGCTGGGCGGACGTGGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167135405 19:47612631-47612653 GAGAGGGGCTGGGGGGCTGACGG + Intronic
1167348549 19:48961696-48961718 GGGTGGGGATTGGGGGACGTGGG + Exonic
1167490093 19:49787787-49787809 GCCAGGGGCTGGGGGGAAGAGGG - Intronic
1167557853 19:50206637-50206659 GAGAGGGTCTGGGAGGAAGTGGG + Intronic
1167569664 19:50279139-50279161 GGGTGGGGTGGGGGAGAAGTGGG - Intronic
1167946363 19:52992312-52992334 GAGTGGTGCTGGTGGCAAGAGGG - Intergenic
1168471313 19:56643113-56643135 GCGGGGGGGTGGGGGGAGGTGGG - Intergenic
1168564553 19:57412221-57412243 GAGTGGGCCTGGGGGGCTGCTGG - Intronic
925926520 2:8675161-8675183 GAGTGGGGCTGGGGGATGGGTGG - Intergenic
925991974 2:9261248-9261270 AAGTGAGGCTGTTGGGAAGTGGG + Intronic
927399904 2:22698711-22698733 GAGAGTGGATGGGGGGAAGATGG - Intergenic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
927875640 2:26653610-26653632 GGGTGTGGCTGGGGTGCAGTGGG - Intergenic
927897407 2:26792725-26792747 GAGTGGGGAAGGGGAGGAGTAGG - Intronic
927965229 2:27263875-27263897 GAGAGGGGCTGAGGGGCAGCGGG + Intronic
928022561 2:27715880-27715902 GGGTCGGGGTGGGGGGAGGTGGG - Intergenic
928072673 2:28233181-28233203 GAGTGGTGCGGGGAGGAAGCGGG - Intronic
928100955 2:28437106-28437128 GGGTGGGGGTGGGGGGAGGCGGG + Intergenic
928135527 2:28684859-28684881 GGGTGGGGCAGGGAGGAAGAAGG - Intergenic
928599688 2:32892032-32892054 GAGTGGGGGTGGGGAGATGTTGG + Intergenic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
928922374 2:36539136-36539158 CAGAGAGGCTGGGGAGAAGTGGG + Intronic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929281611 2:40086793-40086815 GGGTGGGGGTGGCGGGGAGTTGG + Intergenic
929579082 2:43070399-43070421 TGGTGGGGCTGGGTGGAGGTGGG - Intergenic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929961752 2:46502491-46502513 GTGTATGGTTGGGGGGAAGTGGG - Intronic
930376138 2:50569146-50569168 TAGTGGGGGTTGGGAGAAGTGGG + Intronic
930799051 2:55423370-55423392 GCCTAGGGCTGGGGGAAAGTTGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931241700 2:60460320-60460342 GAGTGGGGCTGGAGGGCGATGGG + Exonic
931309127 2:61061920-61061942 GATGGGGGGTGGGGGGAATTGGG + Intergenic
931355756 2:61537220-61537242 CCCTGGGGCTGGGGAGAAGTTGG - Intronic
932165023 2:69498122-69498144 GAGTGGTGCTGGGTTGAATTTGG + Intronic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932689489 2:73900242-73900264 CAGTGGGGCGGGGCAGAAGTGGG - Intronic
932791772 2:74659716-74659738 GACTGGGGCTGCTGGGTAGTAGG - Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933748906 2:85590692-85590714 GGGATGGGCTGTGGGGAAGTAGG + Intronic
933775763 2:85770329-85770351 GAGTGGGGTTGAGGGGAGGTTGG + Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934513468 2:94967737-94967759 AAGTGGGGCTGGGAGGAGATAGG + Intergenic
934601528 2:95662110-95662132 GAGTGGGGTTGGGGGGTACCAGG + Intergenic
934905338 2:98196123-98196145 GGGTGGGGATGGGGAGATGTTGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935221381 2:101016921-101016943 GTGTGGGGTTGGGGGGATGGGGG + Intronic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
936523527 2:113227378-113227400 GAGTGGGGGCAGGAGGAAGTGGG - Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937309547 2:120893687-120893709 GTGGGGGGTTGGGGGGAACTTGG - Intronic
937336614 2:121066186-121066208 GAGCAAGGCTTGGGGGAAGTGGG - Intergenic
938163847 2:129009423-129009445 GAGTGGAGCAGGTGGGAAGAAGG + Intergenic
938995279 2:136671839-136671861 GAGAAGGGAGGGGGGGAAGTTGG + Intergenic
939133457 2:138265816-138265838 GGGTAGGGATAGGGGGAAGTGGG + Intergenic
939629175 2:144513971-144513993 GAGTGGGGTGAGGGGGAAGGAGG - Intronic
939676610 2:145080128-145080150 GGGTGGGGTGGGGGGGAACTAGG - Intergenic
941751842 2:169142554-169142576 GAGTGGGGATGGCTGGAAGGAGG - Intronic
941786865 2:169506351-169506373 GAGTGGAGGTGGGGGGAAGGTGG + Exonic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
942745226 2:179224621-179224643 TAGTGGGGGTAGGGGGAGGTTGG - Intronic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943046659 2:182868135-182868157 GGGCGGGGGTGGGGGGAAGAGGG - Intergenic
943158030 2:184209895-184209917 GAGTGGGGATGTGGGGGTGTGGG + Intergenic
943347654 2:186758934-186758956 GTGTGGGGTTGGGGGAGAGTAGG - Intronic
943406513 2:187494172-187494194 GGATGGGGCGGGGGGGAAGGTGG - Intronic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943589860 2:189784260-189784282 GAGTGGGGCGGCGGGTAAGTGGG - Intronic
944095384 2:195961392-195961414 GGGTGGGGCTGGTGGGTAGTGGG - Intronic
944203838 2:197136395-197136417 GAGTGGGGCTGGGGAGTATCTGG - Intronic
944222604 2:197317420-197317442 GGGTGGGGCTGGGAGGGAGAAGG + Intergenic
944395097 2:199257879-199257901 GTGTTGGGGTGGGGGGTAGTGGG + Intergenic
946159093 2:217825314-217825336 GAGTGTGGCTAGAGGGAGGTGGG - Intronic
946172995 2:217906310-217906332 GAGTGTGGATGGGGAGAAGAAGG - Intronic
946365891 2:219248754-219248776 GAGTGGGGGTGGGTGGGGGTTGG + Exonic
946394154 2:219434946-219434968 GAGCTGGGCTGGGGGGACGCCGG - Exonic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
946865002 2:224034790-224034812 CAGGGGGGCTGCGAGGAAGTGGG + Intronic
946943801 2:224798404-224798426 GGGTGGGGCCGGGGAGAAATGGG + Intronic
947408023 2:229801357-229801379 GAGAGGGGATGAGGGGAATTTGG - Intronic
947433284 2:230049623-230049645 GGGAGGGGTTGGGGTGAAGTGGG + Intronic
947468902 2:230382065-230382087 GTGTGTGGCTGGGGAGAGGTGGG + Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947710366 2:232310243-232310265 AGGAGGGGCTTGGGGGAAGTTGG + Intronic
947885839 2:233570305-233570327 GGGTGGGGGTAGGGGGAAGTTGG - Intergenic
948003594 2:234589412-234589434 GAGCGGGAATGGGGGGATGTTGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948586594 2:239023855-239023877 GCGTGGGGCTTGGGGGAAGAGGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948764197 2:240211205-240211227 GAGTGGGGGTGTGGGGTGGTTGG + Intergenic
949007553 2:241658305-241658327 TGGTGGGGCAGGGGGGCAGTGGG + Intronic
949041777 2:241852931-241852953 GAGCAGGGCTGGGGAGAAGGTGG + Exonic
1168835226 20:873253-873275 GGATGGGGCTGGGTGGGAGTGGG + Intronic
1168953293 20:1817282-1817304 GACTGGGGCTGGGGGGCGATGGG - Intergenic
1169091291 20:2862737-2862759 GGGTGGGGCTGGGAGGGGGTGGG + Intronic
1169193923 20:3673489-3673511 GAGTGGTCCTGGGGGGCCGTGGG + Exonic
1169216258 20:3796412-3796434 GGGTGGGGGGGGGGGGAAGGAGG - Exonic
1169473675 20:5911304-5911326 GAGCGGGGGTGGGGGAAAGGCGG - Intergenic
1169513950 20:6296397-6296419 GAGTGAGGCTGGGAGGAAGACGG - Intergenic
1170149961 20:13219448-13219470 GAGTGCGGGTCGGGGGGAGTGGG - Intergenic
1171191207 20:23161097-23161119 GTTGGGGGCTGGGGGGGAGTTGG - Intergenic
1171394357 20:24821966-24821988 GAGTGGGGATTGGAGGAAGATGG - Intergenic
1171449070 20:25223623-25223645 GACTGGGCCTGGGTGGAAGGTGG + Intronic
1171883682 20:30636171-30636193 GTGGGAGGGTGGGGGGAAGTAGG - Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172130305 20:32650694-32650716 GGGGAGGGGTGGGGGGAAGTTGG - Intergenic
1172272196 20:33660953-33660975 GAGAGGGGCTGGGAGGAGGCTGG - Intronic
1172285086 20:33734552-33734574 GAGTGGGGAGGGGGAGCAGTGGG + Intronic
1172433691 20:34913533-34913555 GGGTGGGGCTCTGGAGAAGTAGG + Intronic
1172587355 20:36093840-36093862 GTGGGGGGCTGGGGGGAGGCCGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172831963 20:37843463-37843485 GACTAGGGCTGTGGGGATGTGGG + Intronic
1172835311 20:37869572-37869594 GAGAGGGGCTGGGTGGAGGATGG + Intronic
1172945684 20:38686791-38686813 GAGAGGGTCTGGGGGGTAGGCGG + Intergenic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173403837 20:42747943-42747965 GAGTGGAGCAGGGAGGAAGCTGG + Intronic
1173687418 20:44933209-44933231 GAATGGGGGTGGGGCAAAGTTGG + Intronic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1173766139 20:45611278-45611300 GAGTGGGGGTGGTGGGAGGCGGG + Intronic
1173850832 20:46216652-46216674 GAGGGGGGCTGGGGGATAGCTGG + Intronic
1173911416 20:46673749-46673771 GAGTGTGGCAGGGGGCAATTGGG - Intronic
1173997942 20:47353800-47353822 AAGGGGGGTTGGGGGGAAGCAGG + Intronic
1174090055 20:48039580-48039602 AAGGGGGGTTGGGTGGAAGTGGG + Intergenic
1174531854 20:51220520-51220542 GGGTGGGGGTTGGGGGAGGTGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175194568 20:57234068-57234090 GAGTGGGGGTGGGGGGACATGGG - Intronic
1175757051 20:61536461-61536483 GAGTGGGGCAGGGAGGGAGGGGG + Intronic
1175766119 20:61594133-61594155 GAGGTGAGCTGGGGGGAAGAGGG + Intronic
1175867985 20:62191580-62191602 GAGTGAGGCTGGGGAGAGGGAGG + Intronic
1175919312 20:62442617-62442639 TAGTGGGGCTGGTGGGACCTTGG + Intergenic
1175966059 20:62660818-62660840 AAGTGGGGCTGGGGGAAGGAGGG - Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176191295 20:63811351-63811373 GGGTGGGGCTGGGGAGAGGAAGG - Intronic
1176985427 21:15431002-15431024 GACTGGGGGAAGGGGGAAGTGGG - Intergenic
1177125882 21:17192614-17192636 GAAGGTGGCTGGGGGGAAATAGG - Intergenic
1178138077 21:29650804-29650826 GAATGTGGCTGTGGGGAAGGTGG - Intronic
1179184755 21:39076798-39076820 GAGTGGGGTTGGGTGTAAGCAGG - Intergenic
1179411503 21:41167206-41167228 GGGCGGGGGTGGGGGGAAGGTGG + Intergenic
1179432079 21:41328718-41328740 GAGTGGGGCTAGGTGGTATTGGG + Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179530172 21:42012908-42012930 GAGTGGAGGTGGGGGAAAGATGG - Intergenic
1179629220 21:42666345-42666367 GTGTGAGGCTGTGGGGAAGGAGG + Intronic
1179647599 21:42784911-42784933 GAGTGGGGGTGGGGTGGACTGGG - Intergenic
1180063843 21:45403211-45403233 GAGTGGGGCAGGAGAGAGGTAGG + Intergenic
1180105586 21:45616360-45616382 GACTGGGGCTGCTGGGAGGTGGG - Intergenic
1180244936 21:46540559-46540581 GAGTGGGGCAGGTGAGAAGAGGG - Intronic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
1180842557 22:18966102-18966124 GGGTGGGGCTGGGGAGTAGGAGG - Intergenic
1180996979 22:19970579-19970601 GAGTGGGGTGGGGGGGCAGGAGG + Exonic
1181063268 22:20292044-20292066 GGGTGGGGGTTGGGGGCAGTAGG + Intergenic
1181388168 22:22559340-22559362 TAGAGGGCCTGGGAGGAAGTGGG - Exonic
1181854282 22:25771027-25771049 GTATGGAGCTGGGGTGAAGTGGG - Intronic
1181967639 22:26668082-26668104 GAATTAGGCTGGGGGGATGTGGG + Intergenic
1181997162 22:26892056-26892078 GGGTGGGGGTGGGGGCAGGTAGG + Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182249921 22:28992156-28992178 GCGGGGGGTTGGGGGGAAGAGGG - Intronic
1182463070 22:30495767-30495789 GAGGTGGGCTGGGGGGACTTGGG + Intronic
1182707408 22:32294547-32294569 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1182714141 22:32341386-32341408 GGGAGGGGCTGAGGGGAACTGGG - Intergenic
1183338071 22:37262321-37262343 GAATGGGGTTGGTGGGAAGTGGG - Intergenic
1183583892 22:38740957-38740979 GGGTGGGGCTGGGGAGGAGCAGG + Intronic
1184015424 22:41782464-41782486 GGGAGGGGCTGAGGGGAAGGAGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184236863 22:43187344-43187366 GCGGGGGGCTGGGGGGAGGACGG - Intergenic
1184298867 22:43543335-43543357 GAGAAGGGCTGGGGGCAGGTGGG - Intronic
1184333427 22:43840081-43840103 GAGTGGGGCCAAGGGGAAGGGGG + Intronic
1184371171 22:44082999-44083021 AGGTGAGGCTGGGGGGATGTTGG + Intronic
1184395749 22:44238000-44238022 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1184401457 22:44276976-44276998 GGGAGGGGCTGAGGGGAACTGGG - Intronic
1184498818 22:44859837-44859859 GAGTGGGGAAGGGGGGAGCTTGG + Intronic
1184593781 22:45502602-45502624 GAGAGGGGGTGGGGGGAGGAGGG + Intronic
1184782520 22:46656297-46656319 GAGTGGGGCTGGTGAGATGCAGG + Intronic
1184824095 22:46935437-46935459 GACAGGGGCTGCGGGGGAGTGGG - Intronic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
1185014047 22:48333246-48333268 GAGTGAGGCTGGAGGGAGGCGGG - Intergenic
1185336797 22:50274625-50274647 GAGAGGTGCTGAGGGGAGGTGGG - Intergenic
1185344775 22:50306489-50306511 GAGCGAGGCTGCCGGGAAGTGGG - Intronic
1185398997 22:50606328-50606350 GGCTGAGGCTGGGGGGCAGTAGG + Intronic
949466451 3:4349342-4349364 TAGTGAGGCTGTGGAGAAGTAGG + Intronic
949633304 3:5953519-5953541 GACTGGGGGTTAGGGGAAGTGGG - Intergenic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
949710188 3:6862716-6862738 GAGGGGGGCGGGGGGGAGGAGGG - Intronic
949799139 3:7884127-7884149 GGGTGGGGCTGGGGGCATGGTGG + Intergenic
949838497 3:8294665-8294687 TATTGGGGCTGGGAGGAATTGGG - Intergenic
950008474 3:9705729-9705751 GAATGGGGCTGGGCAGAGGTTGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950163072 3:10774452-10774474 GACTAGGGCTGGGGAGAAGGAGG + Intergenic
950183704 3:10932426-10932448 GAGTGGGGCTGGTGCACAGTAGG - Intronic
950404617 3:12796924-12796946 GAGTGGGCCTGTGGGGAGGGGGG - Intronic
950601195 3:14037199-14037221 GAGAGGCGCGGGCGGGAAGTGGG + Intronic
950676033 3:14555070-14555092 GAGTGGGGGTGGGGAGGAGCTGG - Intergenic
951543752 3:23806393-23806415 GAGCGGGGGTGGGAGGGAGTTGG + Intronic
951657818 3:25028911-25028933 GAGTAGGGGTGGGGTGGAGTTGG - Intergenic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952115389 3:30174064-30174086 GGGTGGGGCGGGGGGGGAGCAGG - Intergenic
952145077 3:30523616-30523638 AAGTGGGGCTTGGGGAAGGTAGG + Intergenic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
952820856 3:37484341-37484363 GGGTGGGGCTGGGAGGATGCCGG + Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953013104 3:39047039-39047061 GGGTGGGGGTGGGGGGATGGGGG - Intergenic
953210101 3:40868151-40868173 GGGTGGGGCTGGGTGGAGGTGGG + Intergenic
953254191 3:41273677-41273699 GAGTGGGGGTGTGGGGAGGTGGG + Intronic
953405588 3:42658203-42658225 GAGTGGTGCTGGGGGAAGGGCGG + Intronic
953410490 3:42688078-42688100 GAGTGGGGCTGGGCTGAGGCTGG + Intronic
953435055 3:42871505-42871527 GGCTGGGGCTGTGGGGAAGCAGG - Intronic
953449684 3:42995860-42995882 GAGTGGGGCTGGGATCAAGAGGG - Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
953974382 3:47371376-47371398 GGGTGGGGGTGGGGGGGAGGGGG - Intergenic
954217694 3:49133530-49133552 GAATGGGGCTGGGGGAGAGATGG + Intergenic
954349392 3:50030169-50030191 GGGTGGGGCGGGGGTGAGGTGGG + Intronic
954380841 3:50218255-50218277 TGGAGGGGCTGTGGGGAAGTGGG - Exonic
954413410 3:50381119-50381141 GACAGTGGCTGGGGGGAAGCGGG + Exonic
954464556 3:50646868-50646890 GAGTGGGGCTGCCGGGCAGGAGG + Intronic
954466479 3:50658091-50658113 GAGTGGGGCTGAGGAGATGTTGG + Intergenic
954659341 3:52218688-52218710 GGGTGGGGCTGGGTGGGAGGCGG - Intergenic
954672893 3:52299935-52299957 GAGAGCGGGTGGGGGGAAGGAGG + Intergenic
955058314 3:55474886-55474908 AGGTAGGGCTGGGGGGAGGTTGG + Intronic
955236297 3:57142677-57142699 GGGCGGGGCGGGGGGGAGGTTGG + Intronic
955401518 3:58595127-58595149 GAGTGGGACTGGGGGGGTGTGGG - Intronic
955672991 3:61421444-61421466 GAATGGGGGTGGGGGGGGGTGGG - Intergenic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
955990714 3:64624069-64624091 GAGGGGGGATGGGGAGATGTTGG + Intronic
956606576 3:71078990-71079012 GAGTGGGCGTGGTAGGAAGTGGG - Intronic
956791121 3:72680841-72680863 CCGTGGGGCTGGCAGGAAGTGGG - Intergenic
957028622 3:75214568-75214590 GAGTCGGGCTGGGGGCGACTGGG - Intergenic
959019164 3:101169408-101169430 GAATGGGGGTGGTAGGAAGTGGG + Intergenic
959937277 3:112042083-112042105 GAGTGGGTTTGCGGGGAGGTGGG + Intronic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960460334 3:117926365-117926387 GATTGTGACTGGGGGGAAGAAGG + Intergenic
960721229 3:120626321-120626343 GAGCGGGGATGGGGAGAGGTGGG - Intergenic
961081385 3:124032264-124032286 GAGAGGGGCTGGGGAGGAATGGG - Intergenic
961117303 3:124341535-124341557 AAGTGGGGCAGTGGGGAAGGTGG + Intronic
961161081 3:124726644-124726666 GTGGGGGGTTGGGGGGACGTGGG - Intergenic
961211416 3:125128841-125128863 GAGGGGGGAATGGGGGAAGTAGG + Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961424664 3:126835473-126835495 GAGTGGGGCTGGGAGGAGTGGGG + Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962271108 3:133978701-133978723 GAGTGGCCCTGGGGAGAAGATGG + Intronic
962527213 3:136247629-136247651 GGGTGGGGGTAGGAGGAAGTTGG - Intergenic
962924356 3:139977702-139977724 GGGAGGGGGTGGGGGGCAGTGGG + Intronic
963512653 3:146268181-146268203 GAGTGGGGAGGAGGGGACGTGGG + Intergenic
963514150 3:146288037-146288059 GAGTTGGGGTGGGGGGATGGAGG - Intergenic
963729736 3:148959687-148959709 GAGTGATGCTGTGAGGAAGTAGG - Intergenic
964209633 3:154212595-154212617 GTGGGGGGCTGGGGGGTAGGTGG + Intronic
964376229 3:156051779-156051801 GAGAGGCGCTGGTGGGAACTGGG + Intronic
964421525 3:156509068-156509090 GAGTGGGGCGGAGGGGAAAGAGG + Intronic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
965032318 3:163388018-163388040 GAGTGGGGAGGTGGGGAAATGGG + Intergenic
965288488 3:166846376-166846398 TAGTGAGGCTGTGGGGAAATAGG - Intergenic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966266046 3:178044669-178044691 GAGAAGGGATTGGGGGAAGTAGG + Intergenic
966542249 3:181105351-181105373 AAGGTGGGCTGGGGGGAGGTGGG - Intergenic
966917111 3:184591077-184591099 GAATGGCCCTGGGAGGAAGTGGG + Intronic
966941767 3:184752463-184752485 GAGAGGGGTTGGGTGGAAGCTGG + Intergenic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967941207 3:194768032-194768054 GAGTAGAGCTGGGGTGAGGTGGG + Intergenic
968519438 4:1029002-1029024 GGGTGGGGCTTGTGGGAGGTGGG + Intergenic
968607328 4:1541685-1541707 GTGTCGGGCTGGGAGGAGGTGGG - Intergenic
968644866 4:1735414-1735436 GTGTGCAGCTGGGGGGACGTGGG - Intronic
968808319 4:2788822-2788844 GAGTGGGGATTGGGGGAGGTAGG + Intergenic
969053397 4:4387538-4387560 GGGCGGGGCGGGGGGGAAGTGGG - Intronic
969146764 4:5130772-5130794 GAGTGGGGCAGGGTGGAGGAAGG - Intronic
969168617 4:5340310-5340332 GAGTGGGGCAGGGGCCGAGTTGG + Intronic
969197073 4:5571560-5571582 GAGAGGAGCAGGGAGGAAGTGGG - Intronic
969376978 4:6769369-6769391 GAGTGGGGGTGGGGAGAGGAAGG - Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969643330 4:8412215-8412237 GAGTGGGGCTAGGAGAAAGTAGG - Intronic
969661578 4:8532673-8532695 GGGTGGGGGTGAGGGGAGGTGGG + Intergenic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971757341 4:30720970-30720992 CAGTGGGGCTGGGAAGAGGTGGG - Exonic
972251791 4:37309587-37309609 GAGAATGGCTGGGGGGAGGTGGG + Intronic
972552000 4:40142325-40142347 GAGTTGGGCTGGGGGTGACTGGG + Intronic
973367338 4:49218442-49218464 GTGGGAGGGTGGGGGGAAGTAGG - Intergenic
973637248 4:52871508-52871530 GAGGGGGGCTTGGGGGAAGGAGG - Intergenic
973819156 4:54647428-54647450 GAGCGGGGGTGAGGGGCAGTAGG - Intergenic
974548955 4:63348632-63348654 GAGCTGGGCTGGGGGGATGGGGG + Intergenic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975394018 4:73853885-73853907 GAGTTGGGCAGTGGGGCAGTGGG - Exonic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
976565506 4:86547321-86547343 GAGAGGCGCTGGGGGGAACCAGG + Intronic
976700719 4:87966360-87966382 GAGTGGGGTTGGGGCCAAGCCGG + Intergenic
976722907 4:88187147-88187169 TAGTGTGGCAGGGGAGAAGTGGG + Intronic
976801915 4:89002506-89002528 GAGCAGGGCTTGGGGGAGGTGGG - Intronic
977238985 4:94543574-94543596 GAGGTGGGCTGGGGAGATGTTGG - Intronic
977598286 4:98908172-98908194 GATTGGGGGTGGGGTGAAGGTGG - Intronic
977750686 4:100606904-100606926 GACTGGGGTTGGGGGGAAAGGGG - Intronic
977859421 4:101938306-101938328 TAGTGAGGATGGGGGAAAGTGGG + Intronic
977922124 4:102657214-102657236 GAGTGGGGTGGGGGGGGGGTGGG + Intronic
978005407 4:103609738-103609760 GAGAGGGGATGGGGAGAGGTTGG - Intronic
978110334 4:104956185-104956207 GAGTGGGGCTGGGGAGATATTGG - Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
978833013 4:113112402-113112424 GAGTGGGGTTGGGAGGATGCAGG + Intronic
979129260 4:117019975-117019997 TAGTGGGGCTGTAGGGGAGTGGG + Intergenic
979700415 4:123660084-123660106 GACTGTGGCTGGGGTGAAGGAGG + Intergenic
979822527 4:125191952-125191974 GAGAGGCGCAGGGGGGAACTGGG + Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981798431 4:148627146-148627168 GAATGGGGATGGGGAGAAATGGG + Intergenic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982094070 4:151905070-151905092 GAGTGGTGCAGGGTGGAGGTCGG + Intergenic
982136281 4:152277012-152277034 GAGTGGGGCTGGGGTGCGGGTGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
982267841 4:153556107-153556129 TACTGGGGCCGGGGGGAGGTGGG + Intronic
982310189 4:153976283-153976305 GAATGAGGCTGGAGAGAAGTTGG - Intergenic
982806314 4:159769224-159769246 GAGTGGGGAAAGGGGAAAGTGGG - Intergenic
983153939 4:164320803-164320825 GAGTGGGGCTGGGGGGTTGTAGG + Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984205713 4:176785538-176785560 GAGTGGGGATGTGAGGAGGTGGG - Intronic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986311139 5:6551927-6551949 GGGCGGGGGCGGGGGGAAGTAGG - Intergenic
986812668 5:11376833-11376855 GGGTGGGGCTGGGGAGAGATGGG - Intronic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987230514 5:15889086-15889108 AAGTGGGGCGGGGGGAAAGAAGG + Intronic
987282589 5:16426116-16426138 GGGTGGGGCAGGGAGGAAGGGGG - Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988609429 5:32711195-32711217 GGGTGGGGGTGGGGAGATGTGGG - Intronic
988740346 5:34063518-34063540 TGGGGGGGCTGGGGGGAAGCTGG + Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
989520622 5:42396396-42396418 GAGGGGGGCTGAGGGCAACTCGG + Intergenic
989601289 5:43203085-43203107 CGGTGGGGCTGGGGGGATGGTGG - Intronic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
991445732 5:66698359-66698381 GAGTGGGGATGGGTGGAAAGGGG - Intronic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992365046 5:76082814-76082836 GGGTGGGGGCTGGGGGAAGTAGG + Intergenic
992447958 5:76850750-76850772 TGGAGGGGCTGGGGAGAAGTTGG + Intronic
992478847 5:77130137-77130159 GAGTGGGGCGGGGGTGAGGGAGG + Intergenic
992551764 5:77866268-77866290 GAGTGGGGCGGGTGGGAGGGAGG + Intronic
992829843 5:80583535-80583557 GAGTGGTGCTGGGGTGGAGAGGG + Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993987030 5:94609861-94609883 GAGTGGGGCTGGTTGTAAATGGG - Intronic
994390729 5:99190060-99190082 TAGTGGGGGTGGGGGGAGATAGG - Intergenic
994668603 5:102738455-102738477 GGGCGGGGTGGGGGGGAAGTGGG + Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
995655206 5:114418568-114418590 AAGTGGGGCTGGCGGGGAGTTGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997023485 5:130029823-130029845 GAGTGGGGATGGGGGTTGGTAGG - Intronic
997235349 5:132269279-132269301 GACTGGGACTGGGAGGAAGGAGG - Intronic
997783148 5:136680193-136680215 GCCTGGTGCTGGGGGGAAGCAGG - Intergenic
997833070 5:137169193-137169215 GTGAGGGGTTGGGGGGAAGTGGG + Intronic
998449094 5:142220672-142220694 GAATTGGGCTGTAGGGAAGTCGG - Intergenic
998490553 5:142542621-142542643 GGGTCGGGCTGGGGGGTGGTGGG - Intergenic
998707736 5:144782959-144782981 GCGGGGGGGTGGGGGGAAGAGGG + Intergenic
998915799 5:147010295-147010317 GACTGGGGCAGGGTGGAAGGGGG + Intronic
999132444 5:149294809-149294831 GGCTGGGGCTGGGGGGAGGTGGG - Intronic
999288820 5:150410068-150410090 GCGGGGGGCGGGGGGGAAGTGGG + Intronic
999330816 5:150672263-150672285 GAATGGGGGTGGGGCGAGGTGGG + Intronic
999411433 5:151353469-151353491 GCGTGGGGCTGGGGGTATATGGG - Intergenic
999455233 5:151709737-151709759 GAGTGGGGGTGGCGGGGGGTGGG + Intergenic
999939143 5:156521703-156521725 TAGTGAGGCTGTGGGGAAATAGG + Intronic
1000111649 5:158113781-158113803 GAGTAGGGCTTTGGGGAAGAAGG - Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001440571 5:171739727-171739749 TTGTGGGGCTGGGGTGGAGTGGG - Intergenic
1001821853 5:174716558-174716580 TAGTGGGGGTGGGTGGGAGTGGG + Intergenic
1001837428 5:174843939-174843961 GACTGGGGCTGGGTGGGGGTGGG + Intergenic
1001926662 5:175642129-175642151 AAATGGGGTTGGGGGGAATTAGG + Intergenic
1001959855 5:175873100-175873122 GGGTGGGGGTGGGTGGGAGTGGG - Intronic
1002193861 5:177491969-177491991 GTGGGGGCCTGGGTGGAAGTGGG + Intronic
1002587149 5:180256395-180256417 GGGTGGGGCAGGGGGGCAGGGGG + Intronic
1002642719 5:180638088-180638110 GAGGGGAGCTGGGGAGAGGTAGG - Intronic
1002900745 6:1407760-1407782 GAGTGTGGGTGGGGGGCACTGGG - Intergenic
1002945791 6:1759885-1759907 GTGGGGGGCTGGGGCGCAGTAGG - Intronic
1003098527 6:3159742-3159764 GGGTGGGGGTGGGGAGAAGGTGG - Intergenic
1003277419 6:4664510-4664532 AAGTGGGGCTGGGTGGGAGGCGG - Intergenic
1003361359 6:5429087-5429109 GAGTGGGGCAGTGGGCAGGTGGG + Intronic
1003386128 6:5669366-5669388 GCGGGGGGGTGGGGGGAGGTGGG - Intronic
1003464799 6:6368728-6368750 GAGTGGGGCTGAGGAGACGGAGG - Intergenic
1003693670 6:8380062-8380084 GGGTGAGGCTGGGGAGAAGTTGG + Intergenic
1004022047 6:11784822-11784844 GAGTGGGGGTTGGGGAAAGTTGG + Intronic
1004251227 6:14024640-14024662 GAGTGGGGCTTGGGGAAAGTAGG + Intergenic
1004814868 6:19301897-19301919 GTGTGGGGCCGGGGGGAGGGCGG + Intergenic
1004924307 6:20403216-20403238 GAGTCGGGCGTGGGGGAGGTGGG + Intronic
1004987166 6:21095558-21095580 GAGGGGGGTTGGGGGGAAAGGGG - Intronic
1005577807 6:27206179-27206201 GATGGGGGCGGGGGGGATGTGGG - Intergenic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005711452 6:28506876-28506898 GAGTGGGGCCGGGGGGATGCAGG - Intronic
1006324776 6:33345507-33345529 GAGTGGGGCCGGGGGAATGGGGG - Intergenic
1006388999 6:33747708-33747730 GAGTGGGACTGGGGAGAGATGGG + Intergenic
1006452739 6:34114554-34114576 GAGAGGGGCTGGAGGAAATTGGG - Intronic
1006627590 6:35408387-35408409 GAATGGAGCTGGGGAGAAGTAGG + Intronic
1006640126 6:35485559-35485581 GAGAGGGGCTGGCGGGAGGGAGG - Intronic
1006717516 6:36130201-36130223 GACCGGGGCTGGAGGGAACTGGG + Intronic
1007073756 6:39054041-39054063 AGGTGGGGCTGGGGTGAAGGGGG - Intronic
1007152036 6:39703069-39703091 GAGTGGGGGTGGGGGGTTGGTGG - Intronic
1007211173 6:40194442-40194464 CAGTTGGGCAGAGGGGAAGTTGG + Intergenic
1007257455 6:40538783-40538805 GACTGGGGCTGGGGGGAAGGAGG + Intronic
1007323120 6:41041326-41041348 GGGTGGGGCTGGGAGGAGGGTGG - Intronic
1007323128 6:41041343-41041365 GGGTGGGGCTGGGAGGAGGGTGG - Intronic
1007373072 6:41439551-41439573 GTGTGGGGCTGGGAGGTAGGAGG - Intergenic
1007830798 6:44636913-44636935 GAGTGGGGCTGGGGTGAGCCAGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007909448 6:45498943-45498965 AAGTGGGCCTGGGGTGATGTTGG + Intronic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1008700797 6:54097015-54097037 TAGTGCGGCTGTGAGGAAGTTGG + Intronic
1009245382 6:61231208-61231230 GACTGGGGCGGGAGGGATGTGGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010263452 6:73842211-73842233 TCATGGGGATGGGGGGAAGTGGG - Intergenic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1011841073 6:91499574-91499596 GAGTGGGGGTGGGGAGAAAGAGG + Intergenic
1012338558 6:98090339-98090361 GTGTGTGGGTGGGGGAAAGTGGG + Intergenic
1012896045 6:104950727-104950749 AAGTGGGGGTGGGGGGAAAGGGG - Intergenic
1013375099 6:109507405-109507427 GAGTGCAGCTGGGGGAGAGTTGG + Intronic
1013468504 6:110439104-110439126 GTTTGGGGCTGGTGGGAATTTGG - Intronic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014390732 6:120859524-120859546 GGGTGGTGTTGGGGGGATGTTGG - Intergenic
1014614267 6:123582854-123582876 GAGTGGGATTGGGGGGGCGTGGG + Intronic
1015025880 6:128532001-128532023 AAGTGGGGGTGGGGGGAAAGTGG - Intergenic
1015667932 6:135652492-135652514 GTGGGGGGCTGGGGGGAGGGGGG - Intergenic
1015817975 6:137230081-137230103 AGGTGGGGCTGGGGAGAACTGGG + Intergenic
1015828722 6:137344659-137344681 CAGTGGGGTTGGGGGTATGTTGG + Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016762495 6:147753689-147753711 GTGAGGGGCTGGGGGGAAGGTGG - Intergenic
1016792866 6:148084357-148084379 GATTTGGGTTGGGGGGAGGTGGG + Intergenic
1016899172 6:149084021-149084043 GAGTGGGGAAGGGGAGGAGTGGG + Intergenic
1016929216 6:149386447-149386469 GAGTGAGGGTGGGGGGTAATGGG - Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1018221044 6:161579719-161579741 GAGAGGGGCTGGGGGTAAAGTGG + Intronic
1019159145 6:170057765-170057787 GAGTGGGGGAGGGGGAAAGGGGG - Intergenic
1019279435 7:192671-192693 GACCGGGGCTGGGGGGAAGGGGG - Intergenic
1019299531 7:296314-296336 GAGAGGGGCTGGGGGGAGAATGG - Intergenic
1019319568 7:409476-409498 GAGTGGGGCCGGGGCGAGGTGGG - Intergenic
1019419798 7:945731-945753 GAGCGGGGCTGGGAGGAGGGAGG - Intronic
1019506266 7:1393036-1393058 GAGATGGGCTGGGGTGAGGTGGG + Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019731024 7:2629728-2629750 GAGTTGTGGTGGGGGGAAGCAGG + Intergenic
1019769820 7:2876622-2876644 GAGTGGGGCTGGCAGGATGCTGG + Intergenic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1020092941 7:5351477-5351499 GTGCGGGGGTGGGGGGAACTCGG + Intronic
1020176010 7:5882666-5882688 GAGTGGGCCTGGGGTGCAGTGGG + Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021240564 7:18195646-18195668 GAGTAGGGCTGAGGAGAAGCAGG - Intronic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021632279 7:22659211-22659233 TTGGGGGGGTGGGGGGAAGTGGG - Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022118900 7:27287714-27287736 GGGTGGGGGTTGGGGGAGGTAGG + Intergenic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022855386 7:34309190-34309212 GAGGGGGGCGGGGTGGAAGGGGG + Intergenic
1022983541 7:35627254-35627276 GACTGGTGCTGGGGGTAAATAGG - Intergenic
1023311729 7:38894445-38894467 GGCTAGGGTTGGGGGGAAGTGGG + Intronic
1023425882 7:40035783-40035805 GACTGGGGATGGGGGGATGGGGG - Intronic
1023505969 7:40899965-40899987 GCGGTGGGCTGGGGGGTAGTGGG + Intergenic
1023847328 7:44129764-44129786 GGGAGGGGCTGGGGGCAAGGGGG + Intergenic
1024202207 7:47118960-47118982 GGCTGGGGCTGGGGAGATGTTGG - Intergenic
1024317193 7:48032111-48032133 GAGTGGGAATGGGGAGATGTTGG + Intergenic
1024969956 7:55059902-55059924 GATAAGGGCTGGGTGGAAGTAGG + Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025139097 7:56448051-56448073 GGGTGGGGCTGGGCGGCAGCCGG - Intergenic
1026539470 7:71267849-71267871 AAGTGGGGGTGGGGGCAGGTGGG - Intronic
1026883055 7:73919761-73919783 GAGTGGGGCTGGGGCCAGGGTGG - Intergenic
1027201080 7:76064264-76064286 TAGTGGGGGTGGGAGGCAGTGGG + Intronic
1027235355 7:76294641-76294663 GAGTGGGGCAGGCTGGAGGTGGG + Intergenic
1027704298 7:81510137-81510159 GGGTGGGGGTGGGGGGTGGTGGG + Intergenic
1027723178 7:81770251-81770273 GCGTGGGGTTGGGGGGAGGCGGG - Intronic
1028106931 7:86889401-86889423 CACTGGAGCTGGGGGGGAGTTGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028775353 7:94669796-94669818 GGGTGGGGCTGTGGGGAGGGTGG + Intergenic
1029082816 7:97988353-97988375 GGGTGGGCCTGGGGTGCAGTGGG - Intronic
1029436856 7:100568494-100568516 GTGTGGGGCGGGGGGGCCGTGGG - Intergenic
1029685651 7:102146004-102146026 GAGTGTGGCTGGTGGAAAATGGG - Intronic
1030141791 7:106311498-106311520 GAGTGGTGCTGGGTAGAAATGGG - Intergenic
1030330834 7:108268616-108268638 GGGTGGGGGTGGGGGGGGGTTGG + Intronic
1030384067 7:108847420-108847442 GAGTGAGGGGAGGGGGAAGTGGG - Intergenic
1030998769 7:116390201-116390223 GAGTGGGGAAGGGGTGAGGTGGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031502191 7:122532519-122532541 GGGTGGGGGTGGGGAGAGGTCGG - Intronic
1031919143 7:127588627-127588649 GAGCGGGGCTGGAGGGACGCGGG - Intronic
1032076342 7:128837900-128837922 GAGTGGGGCTGGGGTGCATAAGG + Intronic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032091841 7:128915217-128915239 GAGGGGGGCGGAGGGGAAGCGGG - Intergenic
1032285461 7:130535730-130535752 GGGTTGGGGTGGGGTGAAGTGGG + Intronic
1032549598 7:132772010-132772032 CCGTGGGGATGGGGGGAACTTGG + Intergenic
1032728787 7:134617041-134617063 GATTGGGGCAGAGGGGATGTTGG + Intergenic
1032989935 7:137382481-137382503 GTGTGGAACTTGGGGGAAGTAGG - Intronic
1033050554 7:138000676-138000698 GGGTGGGGCTGGGGTGAGGGGGG - Intronic
1033126403 7:138711070-138711092 AAGTGGGGGTGGGGGGACGGTGG - Intronic
1033233241 7:139618484-139618506 GCTTGGGACTGGGGTGAAGTAGG - Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1034079486 7:148262989-148263011 GAGTGGGATTGTGGGGAAGGTGG - Intronic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034445784 7:151113571-151113593 GACTGGGGGTGGAGGAAAGTGGG + Intronic
1034563707 7:151897204-151897226 GAGTGAGGGAGGGGGGAGGTGGG + Intergenic
1035251047 7:157597176-157597198 GCCGGGGGCTGGGGGGAAGCAGG + Intronic
1035299379 7:157887413-157887435 GAGTGGGTACTGGGGGAAGTGGG - Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1036301974 8:7574824-7574846 GGGTGGGGACGGGGGGAAGGGGG - Intergenic
1036503039 8:9330830-9330852 GGGTGAGGCAGGTGGGAAGTAGG - Intergenic
1036547266 8:9783789-9783811 GGTTGGGGATTGGGGGAAGTGGG + Intergenic
1036627794 8:10486058-10486080 GAGAGGTGATGGGGGGTAGTGGG - Intergenic
1036722423 8:11188995-11189017 GAGAGGGGATGAGGGGGAGTTGG - Intronic
1036756754 8:11476298-11476320 GACTGGGGATGGGGGAAAGCCGG - Intergenic
1037673352 8:21034310-21034332 GAGTGGGACTGGGAGACAGTAGG + Intergenic
1037674866 8:21043635-21043657 GAGGTGGGGTGGGGGGAGGTGGG - Intergenic
1037768967 8:21788025-21788047 GTGGGGGGCTGGCGGGAGGTCGG - Intronic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1037886713 8:22599552-22599574 GAGCGGGGCTGGGGGGGCGGGGG - Intronic
1038022849 8:23564469-23564491 GAGTGGGGGAGGGAGGGAGTCGG + Intronic
1038038899 8:23707450-23707472 GAGTGGGGGTGGGGGGGGGTGGG + Intergenic
1038074181 8:24051433-24051455 TAGTGAGGCTGTGGGGAAATAGG + Intergenic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038355111 8:26821740-26821762 GGGTGGGGCAGAAGGGAAGTGGG - Intronic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1039100241 8:33933610-33933632 GAGAGGAGCAGGGAGGAAGTTGG + Intergenic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1039448271 8:37649649-37649671 TGGTGGGGCTGGGAGGCAGTGGG - Intergenic
1039610644 8:38916396-38916418 GTGGGGGGCTGGGGGGAAATGGG - Intronic
1039804208 8:40984793-40984815 CAGTGGATCTGGGAGGAAGTAGG - Intergenic
1039879412 8:41615170-41615192 GCGTGGGGCTGGGTTGACGTGGG + Intronic
1040610660 8:48978341-48978363 GAGTCGAGCTGGGCAGAAGTTGG - Intergenic
1041079710 8:54204589-54204611 GACTGGGGATAGGGGAAAGTGGG - Intergenic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1041347048 8:56910194-56910216 GAGAGGGGTTGGGGGGATGGGGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043052970 8:75405134-75405156 GAGTAGGGGTGGGGGGATGGGGG + Intergenic
1043053301 8:75407785-75407807 GGGTGGGGATGGGGGGACTTGGG - Intergenic
1043506035 8:80903929-80903951 GAATGGGGGAGGGGAGAAGTGGG + Intergenic
1043805657 8:84669481-84669503 GAGTGGGGGGGGGGGGAGGGGGG - Intronic
1044236690 8:89839537-89839559 GAGTGAGGGTGGGGGTAAGAGGG - Intergenic
1044269022 8:90218295-90218317 CAGTGGGGCTGAGAGGAGGTTGG - Intergenic
1044345895 8:91103985-91104007 GATTGAGGATGAGGGGAAGTGGG - Intronic
1044601694 8:94011676-94011698 GAGTGGGGAGGTGGGGAAGAGGG + Intergenic
1044800418 8:95948291-95948313 GAGTTGGGCAGGAGGGAAGCAGG - Intergenic
1045480232 8:102586104-102586126 GAGTGGGGTTGGGGAGCAGAAGG - Intergenic
1046057213 8:109093352-109093374 GAGTGAGGCAGGGGAGAAGACGG - Intronic
1046781318 8:118218509-118218531 GGGTGGGGGTGGGGAGATGTTGG - Intronic
1047181122 8:122589138-122589160 GAATGTGGCTGGGTGGTAGTGGG - Intergenic
1047318396 8:123755213-123755235 GAGGGGGGCTGAGGGCAGGTTGG - Intergenic
1047927260 8:129693760-129693782 GAGTGGGGTTGGGGGAATGGGGG - Intergenic
1048136708 8:131753101-131753123 GAGGGAGACTGGGGGGAGGTTGG + Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048520565 8:135150458-135150480 GGGTTGGGGTGGGGGGAAGGGGG - Intergenic
1048623864 8:136163567-136163589 GGGGGGGGCGGTGGGGAAGTAGG - Intergenic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049283968 8:141764596-141764618 GAGTGAGGCTGAGAGGGAGTGGG - Intergenic
1049378870 8:142302222-142302244 GAGTGAAGCTGAGGGGAAGCTGG - Intronic
1049523092 8:143104823-143104845 GAGTGGGGGTGAGGGTAAGCCGG - Intergenic
1049643140 8:143724573-143724595 GAATGGGGCTGGTGGGGAGAGGG + Exonic
1049797794 8:144504513-144504535 CAGTGGGGCTGGGGCCAACTCGG - Intronic
1050052699 9:1619805-1619827 GACGGGGTCTGGGGGGCAGTGGG + Intergenic
1050176330 9:2873048-2873070 GGGTAGCACTGGGGGGAAGTCGG - Intergenic
1050495276 9:6234425-6234447 GACTGGGGATGAGGGGAAGCAGG - Intronic
1050512626 9:6412207-6412229 GAGTCGGGGTGGGGGTGAGTGGG - Intergenic
1050631304 9:7561576-7561598 GAGTGGGGTAGGGGGCAGGTGGG - Intergenic
1050866029 9:10500677-10500699 GGGAGGGGTTGGGGGGAAGTTGG - Intronic
1051073915 9:13207358-13207380 GGTTGGGGCTGGTGGGAGGTGGG - Intronic
1051241639 9:15062878-15062900 GAGTGAGGCTGTGGAGAAATGGG - Intergenic
1051459374 9:17294873-17294895 GAGTGGGGGGAGGGGGGAGTGGG + Intronic
1052077321 9:24159223-24159245 GTGGAGGGCTGGGGGGAAGATGG - Intergenic
1052282089 9:26744896-26744918 GAGTGAGGCTCGGGGGAATCAGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052996052 9:34552131-34552153 GAGTGAGGCTGGGTGGCAGAGGG - Intronic
1053066722 9:35074329-35074351 GCTTGGGGCTGAGGGGCAGTTGG - Intronic
1053305284 9:36980502-36980524 GATTGGGGCTGCTGGTAAGTGGG - Intronic
1055539784 9:77291299-77291321 AAGTGGGGCTGGGGGGTTGGAGG - Intronic
1056092418 9:83217790-83217812 GAGTTGGGGGGTGGGGAAGTGGG + Intergenic
1056665126 9:88575612-88575634 AAGTGGGGTTGGGAGGAAGGTGG + Intronic
1056766557 9:89447774-89447796 AAGTGGTGGTGGGGGGCAGTGGG - Intronic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057365112 9:94412810-94412832 TAGTGGTTCTGAGGGGAAGTAGG + Intronic
1057658212 9:96975280-96975302 TAGTGGTTCTGAGGGGAAGTAGG - Intronic
1057710608 9:97439530-97439552 GAGTAGGGCTGGGGTGAGGAAGG - Intronic
1057716661 9:97501541-97501563 GAGTGGAGGGGGGGGGAAGGAGG + Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057802111 9:98196999-98197021 GCCTGGGGTTGGGGGGATGTGGG + Intergenic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1057987234 9:99729735-99729757 GGGTGGGGGTGGGGGGGGGTGGG - Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058447026 9:105063580-105063602 GAGAGGAGCTGGGGGTAAGATGG - Intergenic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1059283260 9:113152189-113152211 GGGTGGGGCTGTGGTGAAGGAGG - Intronic
1059336011 9:113568873-113568895 GAGTGGGGATGGGGGCAGGATGG + Intronic
1059400358 9:114065716-114065738 GGATGGGGCTAGGGGGAGGTGGG + Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059560888 9:115333631-115333653 GGGTGGTCCTGGGGGGAAGGGGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060254397 9:122014473-122014495 GAGTGGGGAAGGTGGGAAGGTGG - Intronic
1060424018 9:123489703-123489725 GAGTGGGGCTTGGGTTCAGTGGG + Intronic
1060581362 9:124749892-124749914 CAGTTGAGCTGTGGGGAAGTAGG - Intronic
1060816342 9:126637470-126637492 GTGTGGGGGTGGGGGGTTGTGGG + Intronic
1061065609 9:128275845-128275867 GAGTGGGGCTGGGGCTGGGTCGG + Intronic
1061085045 9:128393585-128393607 GAGTGGGGGTGGGAGGACGAGGG - Intergenic
1061133890 9:128722624-128722646 GGGTGGGGTTGGGGTGCAGTTGG + Intronic
1061165472 9:128919762-128919784 GAGTGGGGTCGGGGGGTGGTGGG - Intergenic
1061183565 9:129038728-129038750 AGGTGAGGCTGGGGGGAAGGTGG + Intronic
1061239710 9:129362517-129362539 GAGTGGGGCTCCGAGGAGGTGGG + Intergenic
1061288468 9:129637567-129637589 GAGTGCCGCTGGAGGGAAGGGGG + Exonic
1061391536 9:130319702-130319724 GATTGGGGCTGGTGGGGGGTGGG + Intronic
1061446355 9:130640416-130640438 AAGTGGGGCTGGGAGAGAGTGGG - Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1062087003 9:134654140-134654162 GTGTAGGGCTGGGGGTATGTAGG + Intronic
1062212714 9:135373233-135373255 GGGTGGGGCTGGCGGGCAATGGG + Intergenic
1062303009 9:135886369-135886391 GAGTGGGGCAGTGGGGCAGTGGG + Intronic
1062412482 9:136432062-136432084 GAGTGGCTCTCAGGGGAAGTGGG + Intronic
1062551547 9:137089772-137089794 GAGTGGGCCTTGGGAGAAGGAGG + Intronic
1062644657 9:137541349-137541371 GAAAGGGGCTTGGGGGAAGCTGG - Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186188219 X:7042530-7042552 GTGAAGGGCTGGGTGGAAGTTGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186367767 X:8913304-8913326 GTGTAGGGCTGGGCGGTAGTGGG - Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1187145837 X:16636509-16636531 GCCAGGGGCTGGCGGGAAGTAGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187843930 X:23516617-23516639 GTGGGGGGCTGGGAGGAAATGGG - Intergenic
1188004847 X:25010207-25010229 GAGGAGGGCTGGGGGCCAGTGGG - Intronic
1188197454 X:27254859-27254881 GTGTGGGACTGGGGAGATGTTGG - Intergenic
1188307008 X:28571157-28571179 GAGTTGGGGTGCGGGGAATTAGG + Intergenic
1188971847 X:36627435-36627457 GTGGGGAGCTGGGGGGATGTGGG - Intergenic
1188972065 X:36630041-36630063 GTGGGGAGCTGGGGGGAGGTGGG - Intergenic
1189084351 X:38004784-38004806 GTGAGGTGCTGGGGGGAAGTAGG + Intronic
1189225184 X:39406878-39406900 GAGTAGAGCTGGGGGAAGGTAGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189351117 X:40276545-40276567 CAGTGGGGGTGGGAGGAATTAGG + Intergenic
1189428309 X:40922991-40923013 GACTGGGGGTAGTGGGAAGTGGG + Intergenic
1189858085 X:45243744-45243766 GTGGGGGGCTGGGAGGAAGTGGG - Intergenic
1190076375 X:47320271-47320293 GCATGGGGCTTGAGGGAAGTTGG - Intergenic
1190231778 X:48587791-48587813 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191641636 X:63433598-63433620 GAGTGGGGCTGGGGGGCGGGTGG + Intergenic
1192166696 X:68831175-68831197 GGGCGGGGCTGGGGGGGAGGCGG - Intronic
1192491455 X:71579676-71579698 GAGTGGGGTAGGGCAGAAGTTGG + Intronic
1192565467 X:72159746-72159768 AAGTGGTGCTGGGGGGATGGGGG - Intergenic
1192638751 X:72844471-72844493 GAGTGGGGCTTCTGGGAAGGAGG + Intronic
1192638927 X:72845428-72845450 GACTGGAGGTGGGGTGAAGTGGG + Intronic
1192642785 X:72875380-72875402 GACTGGAGGTGGGGTGAAGTGGG - Intronic
1192642961 X:72876337-72876359 GAGTGGGGCTTCTGGGAAGGAGG - Intronic
1193783163 X:85728667-85728689 GGGTGGCGGTGGGGGGAAGGGGG - Intergenic
1194227734 X:91282026-91282048 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1195101352 X:101557195-101557217 GTGGGGGACTGAGGGGAAGTGGG - Intergenic
1195108677 X:101624039-101624061 GTCTGTGGTTGGGGGGAAGTGGG + Intronic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195824040 X:108977836-108977858 TAGTGCGGTTGGGGAGAAGTGGG + Intergenic
1195959542 X:110371519-110371541 GTGGGGGGCTGGGGGGAGTTGGG - Intronic
1196716888 X:118821081-118821103 GAGAGGGGTTGGGGGTAAGGGGG - Intergenic
1196755647 X:119155205-119155227 TAGGGAGGCTGGGGGCAAGTGGG + Intergenic
1197661025 X:129172645-129172667 GAGTGGTGCGAGGGGGAGGTGGG - Intergenic
1197837552 X:130711640-130711662 GAGTGTGGCAGGGTGGGAGTTGG + Intronic
1197897720 X:131333269-131333291 GTGCGGGGCTGGGGAGAGGTGGG - Intronic
1198221093 X:134603207-134603229 GACTGGGGATGGGGAGGAGTGGG + Intronic
1198279405 X:135126854-135126876 GAGTGGGGCTGGGGTCAAGCAGG + Intergenic
1198291551 X:135245660-135245682 GAGTGGGGCTGGGGTCAAGCAGG - Intergenic
1198602315 X:138296760-138296782 GATTGTGGCTGAGTGGAAGTTGG - Intergenic
1198770009 X:140120463-140120485 GAGTAGTGTTGGGAGGAAGTGGG - Intergenic
1199102200 X:143815543-143815565 TAGCGGGGGTGGGGGTAAGTGGG + Intergenic
1199433763 X:147789671-147789693 GAGTGGGGCTGGACAGAAGCAGG - Intergenic
1199709545 X:150459466-150459488 AAGTGGGGCTTGGAGGAAATGGG - Intronic
1199942359 X:152638443-152638465 GACTCGGGCTGGGGGGTACTCGG + Intronic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1201604755 Y:15772445-15772467 GAGTGGGATTGGGGCGATGTGGG - Intergenic
1201945429 Y:19505039-19505061 GCCTGGGGCTGGTGGGAGGTGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic