ID: 996906691

View in Genome Browser
Species Human (GRCh38)
Location 5:128608971-128608993
Sequence AAGAACAGCACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 8, 3: 57, 4: 372}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996906691_996906699 27 Left 996906691 5:128608971-128608993 CCCACAGTCACTGTGCTGTTCTT 0: 1
1: 0
2: 8
3: 57
4: 372
Right 996906699 5:128609021-128609043 CTGCCATGCAGCTGCTGCGGGGG 0: 1
1: 0
2: 8
3: 33
4: 311
996906691_996906696 24 Left 996906691 5:128608971-128608993 CCCACAGTCACTGTGCTGTTCTT 0: 1
1: 0
2: 8
3: 57
4: 372
Right 996906696 5:128609018-128609040 TCTCTGCCATGCAGCTGCTGCGG No data
996906691_996906697 25 Left 996906691 5:128608971-128608993 CCCACAGTCACTGTGCTGTTCTT 0: 1
1: 0
2: 8
3: 57
4: 372
Right 996906697 5:128609019-128609041 CTCTGCCATGCAGCTGCTGCGGG 0: 1
1: 3
2: 11
3: 70
4: 445
996906691_996906698 26 Left 996906691 5:128608971-128608993 CCCACAGTCACTGTGCTGTTCTT 0: 1
1: 0
2: 8
3: 57
4: 372
Right 996906698 5:128609020-128609042 TCTGCCATGCAGCTGCTGCGGGG 0: 1
1: 1
2: 4
3: 63
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996906691 Original CRISPR AAGAACAGCACAGTGACTGT GGG (reversed) Intronic
900504803 1:3024494-3024516 AATAACAGCACAATGAGTCTTGG - Intergenic
900616045 1:3566137-3566159 AAGAACAGGACAGTGACTGCAGG - Intronic
905629966 1:39512935-39512957 AAGACCAGCTCAGTGCATGTGGG + Intronic
905667793 1:39773255-39773277 AAGACCAGCTCAGTGCATGTGGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906562197 1:46767339-46767361 AAGCACAGCAGTGTGGCTGTAGG + Intronic
907622701 1:55997747-55997769 TAGAACAGCACAGTGCTTGAAGG + Intergenic
908912233 1:69085403-69085425 AAGACCAGCACATTGCCTATTGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910079365 1:83323045-83323067 AAGAATAGCACACAGACAGTGGG - Intergenic
910127764 1:83861962-83861984 AAAAACAGGACACTGTCTGTGGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
913225687 1:116696270-116696292 TAAAAAAGCACTGTGACTGTTGG + Intronic
915283448 1:154838120-154838142 AAGTACAGAACAGAGAGTGTGGG + Intronic
916167581 1:161977587-161977609 AAGAACAACACAGACTCTGTTGG - Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916389992 1:164321112-164321134 AAGAACACCACAGCGGCTGCTGG - Intergenic
917055602 1:170978252-170978274 TAGCACACCACAGTCACTGTAGG - Intronic
917263416 1:173194435-173194457 AAGAACAGAAAAATCACTGTAGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917513046 1:175683926-175683948 ACCAACAGGAGAGTGACTGTGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
920143219 1:203835731-203835753 AAGGACAACACAGTGACTCCTGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920853375 1:209644579-209644601 AAGAACAGCACAGGTAGTTTTGG - Intronic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923018826 1:230147400-230147422 AAGGACAGCAAAGTGAATATAGG - Intronic
923526862 1:234779317-234779339 AAGAGCAGCACATTGGCTGGAGG + Intergenic
923778747 1:237002585-237002607 GAGAACAGCAAAGTGAGTGGAGG + Intergenic
1063233764 10:4091058-4091080 CAGAAAAGCACAGTGCCTGGAGG + Intergenic
1066364818 10:34766817-34766839 AAGATAACCACAGTGACTTTCGG + Intronic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1067397905 10:45940681-45940703 AAGAACAACAAAGTGACTCCTGG + Intergenic
1067723077 10:48744206-48744228 AAGAACACAACAGTAACAGTTGG + Intronic
1067866222 10:49909772-49909794 AAGAACAACAAAGTGACTCCTGG + Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068347868 10:55807401-55807423 AAGAACAACACAGTGGACGTTGG - Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070792136 10:79195799-79195821 AAGAACAGCACATTAACAGCTGG + Intronic
1071295405 10:84215771-84215793 AAGCCCAGCACAGTGCCTGCTGG - Exonic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072697234 10:97612733-97612755 AATAAAAGCAGAGTGCCTGTAGG - Exonic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075262560 10:120975937-120975959 AAGAGGAGCACAGTGAATGAAGG - Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077890693 11:6416093-6416115 AAGACGAGCACTGTGTCTGTTGG - Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078582309 11:12547932-12547954 AAGAACAGTAAGGAGACTGTGGG - Intergenic
1078855027 11:15200352-15200374 AGGAATAGCATGGTGACTGTTGG + Intronic
1079111770 11:17609310-17609332 AAGATCAGCACAGGGACCTTTGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082663454 11:55944916-55944938 ATCAACACCACAGTTACTGTGGG + Intergenic
1082907875 11:58331583-58331605 AAGGACAGCTCAGAAACTGTTGG - Intergenic
1083980504 11:66164321-66164343 AAAAATAGCACAGTGACCCTGGG + Intronic
1085416132 11:76320204-76320226 AAGGACAGCACAGGAACTATGGG - Intergenic
1086100547 11:83094863-83094885 AACGACAGCACTTTGACTGTAGG - Intergenic
1086190162 11:84069619-84069641 AAAAACAGTACATTCACTGTAGG - Intronic
1087030928 11:93703615-93703637 AAGAACAGAACAGTGAAGGTAGG - Intronic
1087220949 11:95545691-95545713 AAGAGCAGGACACTGACTGAGGG - Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1087489534 11:98806716-98806738 AAGAAAAGCAGGGTGACTGATGG - Intergenic
1087655980 11:100923351-100923373 CAGATCAGCACAGTGTCTGAAGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089535294 11:119157161-119157183 AGGAACAGCACTGTGACCTTAGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093376491 12:18434196-18434218 AAGAAAAGCAAACTGACTTTTGG + Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094700290 12:32863263-32863285 AAGAACAACACGGTGACTCCTGG + Intronic
1094770644 12:33654464-33654486 AAAAACTGCAAAGTCACTGTAGG + Intergenic
1095250587 12:39974337-39974359 ATGAACAGCACAGAGAGGGTTGG + Intronic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095783730 12:46087660-46087682 CAGAACTCCACAGTGACTGCTGG + Intergenic
1095819635 12:46463414-46463436 AAGATCAGGACGGTGACTATCGG + Intergenic
1095922916 12:47548983-47549005 AATAACTGCTCAGTGAATGTTGG + Intergenic
1096061028 12:48700622-48700644 TAGAACAGCAGAGTGAAAGTGGG - Intronic
1096225375 12:49863333-49863355 AAGGACACCACAGTGACTCCTGG + Intergenic
1096929214 12:55186269-55186291 AAGAACAGCACTTTCACTGAAGG - Intergenic
1097996366 12:65892078-65892100 AAGACCATCAGAGTGAGTGTCGG - Intronic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098990511 12:77060386-77060408 AACACCAGCACACTGACTATAGG + Intronic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1102262109 12:111449440-111449462 TAGAACAGAACACTGATTGTGGG - Exonic
1103305330 12:119959584-119959606 AAGAATAACACAGTGACTCCTGG + Intergenic
1103346243 12:120252248-120252270 GAGAACAGCACAGTGCTTGGTGG + Intronic
1106146277 13:27052676-27052698 AAAAAAAGCACAGTGGCTTTGGG + Intergenic
1106532615 13:30608021-30608043 GAATACAGCACAGTGACAGTAGG + Intronic
1107453694 13:40535609-40535631 CGGAACAGCACAGGGAGTGTCGG - Intergenic
1107463148 13:40624521-40624543 AAGAACAGCACTCTGACTAAAGG + Intronic
1107908050 13:45079973-45079995 AAGAACAACACATTGATGGTAGG + Intergenic
1109297926 13:60557387-60557409 AAGATCAGAGCAGTGACTGCTGG + Intronic
1110118168 13:71846144-71846166 GAGAACAGCACACTGACTCCTGG + Intronic
1110186758 13:72683816-72683838 TAGAAAAGATCAGTGACTGTTGG - Intergenic
1111744478 13:92249556-92249578 AAGAAAAGAAAAGTGACAGTAGG - Intronic
1112333881 13:98498399-98498421 AATCTCAGCCCAGTGACTGTAGG - Intronic
1112379657 13:98876776-98876798 AAGAACAGCAGGGTGTCTGCAGG + Intronic
1112823707 13:103366629-103366651 AAAACCAGCACAATGATTGTTGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115055006 14:29113638-29113660 AAGCACAGCACAGGGACTAAGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115643377 14:35349982-35350004 AAGTAAACCACATTGACTGTGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116862970 14:50009051-50009073 CAGAACAGCACAGTGAGTTTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1118762625 14:68890055-68890077 AAGAATAGCATAGTGGCTGCTGG + Intronic
1119489486 14:75018473-75018495 AAGCACAGCAAATTCACTGTTGG - Intronic
1119966219 14:78918422-78918444 AAGAACAGAACAGAGACCTTGGG + Intronic
1120758516 14:88266010-88266032 CAGCACAGCACAGTGAGTGCTGG - Intronic
1122252319 14:100448744-100448766 AAGAACAGGGCAATGACTGGAGG + Intronic
1122454731 14:101841621-101841643 ACCAACACCACAGTGACCGTGGG - Intronic
1122738333 14:103856405-103856427 AAGACCAGTACAGTGTGTGTAGG - Intergenic
1123763770 15:23454380-23454402 AAGAAAAGAAAAGTGACAGTAGG - Intergenic
1124853430 15:33362975-33362997 AACAACAGGGCAGTGACTTTTGG + Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126410218 15:48366184-48366206 AAGAGCAGAAAAGTGACAGTGGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1128287141 15:66446602-66446624 AAGAACAACACAGTGACTCCTGG - Intronic
1131666088 15:94572466-94572488 AAGAACAGAACTGTGGCTGAGGG + Intergenic
1131863911 15:96686316-96686338 ACGATCAGCACAGTGAATGTTGG - Intergenic
1132869908 16:2111343-2111365 CAGAACTGCACAGTGACCGTGGG - Exonic
1133065887 16:3206862-3206884 AAGAACAGCAGAGTGAGGCTGGG + Intergenic
1134027420 16:10964961-10964983 ATGTACAGCACAGTGACTACAGG - Intronic
1134288278 16:12881329-12881351 AAGAACAACACAGTGACTCCTGG + Intergenic
1134717514 16:16364258-16364280 CAGAACTGCACAGTGACCGTGGG + Intergenic
1134957238 16:18387901-18387923 CAGAACTGCACAGTGACCGTGGG - Intergenic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1139668790 16:68477399-68477421 AAGAACAACACAGTGACTCCTGG - Intergenic
1141292769 16:82735382-82735404 ATGAATAGCACAGTCACTGCAGG - Intronic
1142648248 17:1329173-1329195 AAGTACACCACAGAGACTGCTGG + Intergenic
1143779918 17:9224036-9224058 AAGAACAGAGCAGAGGCTGTGGG - Intronic
1144275232 17:13660495-13660517 AAGTTCAGCACAATGTCTGTTGG + Intergenic
1146028110 17:29340645-29340667 AAGAACAACAAAGTGACTCCTGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1149210948 17:54299858-54299880 CTAATCAGCACAGTGACTGTAGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151090861 17:71438857-71438879 AACAACAGCACAGTTAATGGGGG - Intergenic
1151426671 17:74035204-74035226 AAGCACAGCTCCGTGGCTGTGGG - Intergenic
1152145676 17:78567309-78567331 AAGAACAGCACAGACACAGAGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154056860 18:11021296-11021318 AAGAACACCACACTGACTTTGGG - Intronic
1155329378 18:24699209-24699231 AAGAAATCCACAGAGACTGTGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155895516 18:31320818-31320840 AAGTACAGCATGGTCACTGTGGG + Intronic
1156222947 18:35072108-35072130 AAGAACAGCACAGTAATATTTGG - Intronic
1157691245 18:49683469-49683491 AAGAACAGGAAAGGGACAGTGGG + Intergenic
1157877606 18:51288071-51288093 GAGAGCAGCAAAGTGACTGCTGG - Intergenic
1157991723 18:52504516-52504538 AAGTAAAGCACAGTGGCTGTGGG + Intronic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1160007156 18:75075891-75075913 AACAACAGCACAGAGCCTTTTGG - Intergenic
1165140998 19:33699824-33699846 CAGAACATGACAGTCACTGTAGG - Intronic
1165314425 19:35046041-35046063 AAGACCAGCCCAGTGGCTGTCGG + Intronic
1167511227 19:49896283-49896305 GAGAGCAGGACAGTGACTGGGGG - Intronic
925042506 2:742942-742964 AAACACAGGACAGTGACTGAAGG + Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925827950 2:7868823-7868845 AAGAAAAGCAGAATCACTGTGGG - Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
929070687 2:38027933-38027955 AAGATCAGGACAGTCAATGTTGG - Intronic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929445787 2:42000052-42000074 AAGAACAGGAGAGTGAAAGTAGG - Intergenic
929525170 2:42694565-42694587 AAGAACATCACAGTGACCAGGGG - Intronic
930072169 2:47375432-47375454 AAGAATAGCACAGAGATTCTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931139135 2:59438003-59438025 AACAACAGCACAGGGACTGTGGG - Intergenic
931568596 2:63643710-63643732 ATGAACAGCAGAGTGACCCTTGG + Intronic
931612339 2:64115538-64115560 CAGAAAAGCCCAGTGACTGAAGG + Intronic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
932278184 2:70467247-70467269 GAGAGCAGCACAGTCAGTGTTGG + Intronic
933054820 2:77648334-77648356 AAGAAATGCACTGTAACTGTGGG + Intergenic
937011826 2:118569753-118569775 AAGAACTGCACAGTCTCTGCAGG - Intergenic
937085364 2:119168251-119168273 AAAAATAACACAATGACTGTTGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943839047 2:192554049-192554071 AAGAACAGCACAGAATGTGTGGG + Intergenic
945010652 2:205459625-205459647 AGGAGCACAACAGTGACTGTAGG - Intronic
945523923 2:210864812-210864834 AAGAACAGGCCAGGGACAGTGGG + Intergenic
947594358 2:231401411-231401433 AGGATCAGCACAGTGGCTGAAGG + Intergenic
948578855 2:238970806-238970828 AAGAGCAGCACAGCCTCTGTGGG - Intergenic
948877071 2:240835230-240835252 AACAAAAACACAGTCACTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170308344 20:14964750-14964772 AAGTATAGCACAGTGGCTATGGG - Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171456976 20:25277650-25277672 TAGAACAGCACACAGACTGGAGG - Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171955333 20:31457636-31457658 ATGAGCAGGACAGTGACTGCAGG - Intergenic
1171959355 20:31482718-31482740 CAGGATAGCACAGAGACTGTAGG - Intronic
1172838890 20:37890201-37890223 AGGAACAGCGCAGTGAATGTGGG + Intergenic
1173610226 20:44361810-44361832 AAGGACAGCAAAGGCACTGTGGG + Intronic
1173713456 20:45180466-45180488 AAGGACAACAAAATGACTGTGGG + Intergenic
1174014695 20:47478359-47478381 AAGAACAGGACAGTGACTCCCGG - Intergenic
1174356374 20:50000903-50000925 CAGAAAATCACTGTGACTGTGGG - Intergenic
1174525478 20:51167331-51167353 AAGAACAGCTCAGTGAGTCTGGG + Intergenic
1174735174 20:52959437-52959459 AAGAGCTGCACATTGACAGTGGG - Intergenic
1179101825 21:38361054-38361076 AAGCAGAGGACAGTGACTGAGGG - Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182762101 22:32731004-32731026 GAGAAAAGCACAGGGACTCTGGG - Intronic
1182970190 22:34566542-34566564 AAGACCAGAACAGAGACTCTGGG - Intergenic
1184353000 22:43957175-43957197 AAGAACAACATAGTGACTCCTGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951398612 3:22202749-22202771 AAAGACAGCACATTGAATGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953343781 3:42158014-42158036 AAGAACACTACAGTGAATGCCGG - Intronic
953829820 3:46286581-46286603 AAAAACAACACAGTGAATGAAGG - Intergenic
955613942 3:60785465-60785487 AATATCAGTACAGTGAATGTTGG - Intronic
956384561 3:68703022-68703044 AAGAATGGCACAGTGAATGCAGG + Intergenic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957506936 3:81134178-81134200 AAGAACAGTACATTGAATTTTGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960331974 3:116371079-116371101 AACAACAGCCCAGTAACTGATGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960530138 3:118755158-118755180 AACAACAGCAGAGAGACTGAGGG - Intergenic
960576381 3:119233963-119233985 AAGACCAGCCAAGTGACTGGAGG + Intronic
961018467 3:123484813-123484835 AAGAACAACACACTTACTGAAGG + Intergenic
961022292 3:123518373-123518395 AAGAAAAGCATGGTGACTGGAGG - Intronic
962010664 3:131387402-131387424 AAGAATAGCAAAGGGACTTTGGG + Intronic
963003007 3:140700760-140700782 ACGACCACCACAGTGGCTGTTGG - Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963917180 3:150869509-150869531 AAGAAAAGCAGGATGACTGTCGG - Intergenic
964120380 3:153177393-153177415 AACAACTACACAGTGACTTTAGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964397012 3:156256451-156256473 AAGCACTGCACAGTGACCCTGGG - Intronic
964781440 3:160342843-160342865 AAGAACAACATAGTGACTCCTGG + Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
966266397 3:178049737-178049759 AAGGACAGAAAAGTGACTGATGG - Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
971561668 4:28085485-28085507 AAGAACAGCACCATGAGAGTAGG + Intergenic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
972964100 4:44487694-44487716 AAGAACAGTCGAGGGACTGTAGG - Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974945369 4:68520814-68520836 AAGAAAAGCCCAGTGTCTGACGG - Intergenic
975085915 4:70339675-70339697 AAGAACAGCACACTGGCAATTGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976875642 4:89850518-89850540 TACAACAGCACAGGGACTCTGGG + Intergenic
978055793 4:104264375-104264397 CAGAAGAGCACAGTGAATGAGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978646455 4:110938170-110938192 AAAACCAGCACAGTGGCTGTTGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981872056 4:149498300-149498322 CAGAACAGCTCTGTGACTCTTGG + Intergenic
982123909 4:152168105-152168127 AATAAAAGCTCTGTGACTGTTGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983502767 4:168518486-168518508 AAGAACCCCACTGTGACTGGGGG - Intronic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984877752 4:184384748-184384770 AAGAACAGGGCTGGGACTGTTGG - Intergenic
985721421 5:1491440-1491462 AAGAACAGAACAGTGACGTGGGG + Intronic
986143021 5:5049493-5049515 TAGGACAGGACAGTGACTATGGG - Intergenic
986677052 5:10195156-10195178 AAGCACAGCTCAGTGATTGGTGG + Intergenic
986753276 5:10810194-10810216 GCCACCAGCACAGTGACTGTGGG - Intergenic
986953566 5:13121990-13122012 AAAAAGAGCACAGTGTCTGAGGG - Intergenic
987244820 5:16038035-16038057 AAGAATCCCACAGTCACTGTGGG + Intergenic
987607366 5:20154614-20154636 AAGAATGGCACAGAGACTGAGGG - Intronic
988062923 5:26197118-26197140 AAGAATATCAGAGTTACTGTTGG + Intergenic
988249789 5:28741872-28741894 AAGAATAGCACAGTGATGATAGG - Intergenic
989588550 5:43092625-43092647 CAGAACAGCAAAGAGACTTTGGG + Intronic
991514264 5:67416439-67416461 AAAAAGACCACAGTGACTATAGG + Intergenic
991678724 5:69116321-69116343 AAAACCAACACAGTAACTGTCGG - Intronic
991957778 5:72013120-72013142 AAGACAAGCACAGTGACTTTAGG - Intergenic
992045004 5:72879004-72879026 AAGAACAACACAGAGACTCCTGG - Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993559077 5:89381097-89381119 AAGCACAGAACAATGACTCTAGG - Intergenic
993709552 5:91211169-91211191 CAGAACAGCACAGTCACAGCAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994589661 5:101758074-101758096 AAGAACAGTCAAGGGACTGTAGG + Intergenic
995042306 5:107602858-107602880 TAGAAGAGCACAGTGACTAGAGG + Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995613893 5:113940155-113940177 AATAACAGCACAGTCATTCTTGG - Intergenic
995920057 5:117301261-117301283 AAGAACAACACAGTGACTCCTGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996783303 5:127212224-127212246 AATAACAACCCTGTGACTGTTGG + Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
998012503 5:138706667-138706689 AAAAACATCACAGTGAGTGAAGG + Intronic
999551743 5:152695080-152695102 AAGAACAGCAAAGGGATAGTGGG - Intergenic
1001265518 5:170271455-170271477 AAGAACAGCACAGCCTCTGACGG - Intronic
1004252551 6:14034081-14034103 AACAACAGCAAGGTGCCTGTGGG + Intergenic
1005571897 6:27153347-27153369 AAGAAGAGGACAGTGAATCTAGG + Intergenic
1006608742 6:35279326-35279348 AAGAACAACACACTGACTGCTGG - Intronic
1007187380 6:39983845-39983867 AAGAAAATTACAGTGACTTTTGG - Intergenic
1007373047 6:41439437-41439459 AAGGACAGGAAAATGACTGTAGG - Intergenic
1008303677 6:49873983-49874005 AAGAAAATCAAAGTAACTGTGGG - Intronic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010890640 6:81306195-81306217 AAGAACATTCCAGTGACTGGTGG + Intergenic
1011322935 6:86116723-86116745 AGGAACAGCACAAGGATTGTGGG - Intergenic
1011935985 6:92778124-92778146 AAGATCAGCACTGTAACTTTAGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012536996 6:100310989-100311011 AAAAACAGCACAATGAAAGTAGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013189237 6:107788246-107788268 CAGAATAGCAGAGTGACTCTTGG + Intronic
1013570344 6:111417487-111417509 AGGAACAGCACAGTGAGAGCGGG - Intronic
1014932405 6:127349663-127349685 TAGAAAAGCTCAGTGACTGCCGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016939495 6:149472738-149472760 CAAAACAGCAGAGTGGCTGTAGG - Intronic
1017916861 6:158837765-158837787 ATGAGTAGCACAGTGACTCTGGG - Intergenic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022412374 7:30149075-30149097 AAAAACAGCACAGTGACTCCCGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022641682 7:32191408-32191430 GAGAACAGACTAGTGACTGTTGG - Intronic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023994846 7:45153010-45153032 GAGTACAGCACAGTGACAGAGGG - Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1025713899 7:63936103-63936125 AATAACAGCACAGAGAAGGTGGG + Intergenic
1026271003 7:68836814-68836836 AAGAACAACACAGAAATTGTAGG + Intergenic
1027297134 7:76788331-76788353 AAGAATAGCACACAGACAGTGGG - Intergenic
1027921286 7:84399125-84399147 AGGAAAAGCACGGTGAGTGTGGG + Intronic
1027996026 7:85426530-85426552 AAAAATAGCACAGTGAATGGGGG + Intergenic
1028361494 7:89972376-89972398 GAGAACTGCATAGTGTCTGTTGG - Intergenic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028925414 7:96352116-96352138 AAAAGCAGCAGAGTGACTCTAGG + Intergenic
1028977936 7:96934704-96934726 AAGAACAGAATCGTGACAGTAGG - Intergenic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030885702 7:114933989-114934011 AAGAACAGGCCAAGGACTGTAGG - Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032776322 7:135117346-135117368 AAGAACAGAACAGACAATGTAGG + Intronic
1034019207 7:147623136-147623158 AAGAAAAGCACAGGAACTGAAGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034160159 7:148988000-148988022 AAGAACAGCAAAAAGACAGTAGG + Intergenic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1036832081 8:12028638-12028660 AAGAGCAGTTCAGTGAATGTAGG - Intergenic
1037084816 8:14835708-14835730 AACAGAAGCACAGTGACTCTTGG + Intronic
1037787781 8:21912668-21912690 GAGAAGAGGACAGTGACTGCAGG + Intronic
1038429309 8:27486915-27486937 AAGAACAGCACAGTGACCGCAGG + Intergenic
1038863039 8:31408577-31408599 AGGAACTGCACAGCAACTGTGGG - Intergenic
1039093530 8:33857899-33857921 GAGAACAGCACACTGACAGTGGG - Intergenic
1039831056 8:41215353-41215375 GAGAACAGGTCAGTGATTGTGGG + Intergenic
1040743238 8:50605543-50605565 AAGACTAGCACAGCGACTGGCGG - Intronic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041094979 8:54341295-54341317 AACAACAGCCATGTGACTGTTGG + Intergenic
1041222581 8:55666123-55666145 AAGGAAAGCACAGTGACACTGGG + Intergenic
1041242997 8:55864645-55864667 AAAAACTGCACAGTGACTACAGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043788319 8:84430919-84430941 AAGCCCAGCTGAGTGACTGTGGG - Intronic
1044492158 8:92832190-92832212 ATGAACAAATCAGTGACTGTGGG - Intergenic
1044616682 8:94149616-94149638 AGGAACAGCATGGTGAGTGTGGG + Intronic
1045395395 8:101755692-101755714 AAGAACAGCAGTGAGGCTGTAGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047074092 8:121380288-121380310 AAGAACAACACAGTGACTCCTGG - Intergenic
1047338291 8:123956464-123956486 AAGAGGATCACAGTTACTGTGGG + Intronic
1047825456 8:128569252-128569274 AATAATAGCAAAGTTACTGTTGG - Intergenic
1047966172 8:130048490-130048512 CAGCACAGCACAGGGACTTTGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048375111 8:133816509-133816531 AAGGACTGCACAGAGACTGGTGG + Intergenic
1050541647 9:6675443-6675465 AAGAACAACACAGTGACATCTGG + Intergenic
1050620799 9:7450062-7450084 AAGGTCAGCCCAGTGACTGGCGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052072048 9:24093429-24093451 AAGGCCAGCCCAGTGAGTGTGGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052948870 9:34191716-34191738 AAGAACAACACAGTGACTCCTGG + Intronic
1053017123 9:34668235-34668257 AAGAAGAGAACAGTGCATGTGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055013220 9:71589760-71589782 AAGAACAACCCAGTGACTCCTGG + Intergenic
1056254005 9:84779661-84779683 AAGAACATCACAGTAGTTGTGGG + Intronic
1057431927 9:95002960-95002982 TAGAAGAGCAGAGTGACAGTAGG + Intronic
1059795055 9:117685406-117685428 AAGAACAGCACGGTGACTCTTGG - Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060564176 9:124575043-124575065 AGGAACATCACAGTGACTCAAGG - Intronic
1062656507 9:137606576-137606598 GAGGACAGAACAGAGACTGTGGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186434820 X:9533659-9533681 AAGAAAGGCACAGTGATGGTGGG + Intronic
1186945276 X:14559377-14559399 TAAAACAGCACAGTGGCAGTGGG + Intronic
1186995542 X:15117588-15117610 AAGAACAACACAGTGACTCCTGG - Intergenic
1187564550 X:20435473-20435495 GAGAACAGCACAGAGAGTTTTGG + Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188529422 X:31122813-31122835 AAGAACAGCACAATGTCCCTGGG + Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188881141 X:35493289-35493311 AAGAAGAGCACTGTGCATGTGGG + Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189485041 X:41424058-41424080 AAAAAAAGAATAGTGACTGTAGG + Intergenic
1190971261 X:55351065-55351087 AAGAAAAGCACAGGAACTGATGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192759694 X:74084383-74084405 AAGATCAGAACATTGACTATAGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193765915 X:85529068-85529090 AAGAAAAGCCCAGTGTCTGATGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195738274 X:108035645-108035667 AAGTACAGGAAAGAGACTGTGGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic
1201986728 Y:19976794-19976816 AAGAAAAGCACACTGAGTGAAGG + Intergenic