ID: 996909676

View in Genome Browser
Species Human (GRCh38)
Location 5:128640843-128640865
Sequence GATGAACGTTAACATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996909672_996909676 -3 Left 996909672 5:128640823-128640845 CCTGTGAATTAGGTTCTGGAGAT 0: 1
1: 0
2: 0
3: 13
4: 124
Right 996909676 5:128640843-128640865 GATGAACGTTAACATGGGGAAGG 0: 1
1: 1
2: 2
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996909676 Original CRISPR GATGAACGTTAACATGGGGA AGG Intronic
905663080 1:39743417-39743439 GATGATGGTTCACATTGGGAAGG + Intronic
916913266 1:169375756-169375778 AATGAATGATAACAAGGGGAGGG - Intronic
920510525 1:206548452-206548474 GATGCTCATTACCATGGGGAGGG + Intronic
922859288 1:228802343-228802365 GATGAACCTTAATATTTGGAGGG + Intergenic
1067247744 10:44560352-44560374 GAAGGATGTTAACATGGGCAAGG - Intergenic
1068091576 10:52438878-52438900 GGTGAACTTACACATGGGGAGGG + Intergenic
1073615894 10:104994838-104994860 AATGCCCGTTAACATGTGGATGG - Intronic
1077862594 11:6196448-6196470 GACAGACGTTAACTTGGGGAAGG - Intergenic
1080450949 11:32378494-32378516 AATGAGCTTTAACAGGGGGAAGG - Intergenic
1080910904 11:36597497-36597519 GAAGAATGTTAGCATGGGGTTGG - Intronic
1080999402 11:37649866-37649888 CATGAACGCTAACTTGGTGAGGG + Intergenic
1082888265 11:58111162-58111184 GATGAGTGTTAGCATGGGCAAGG + Intronic
1086894100 11:92292405-92292427 GTTGAACATGACCATGGGGATGG + Intergenic
1092201028 12:6583020-6583042 GATGAACGTTCAGAAGGTGAGGG - Exonic
1092771353 12:11899934-11899956 GATGAGTGTTTACCTGGGGATGG + Intergenic
1097489634 12:60249988-60250010 AATGAAGGTTAACATTTGGATGG - Intergenic
1097548660 12:61037975-61037997 GATGCACCTTGACATGGGGTGGG - Intergenic
1103482153 12:121257669-121257691 GATGAAACTGAAGATGGGGAAGG - Intronic
1109455981 13:62589958-62589980 AAGGAATGTTACCATGGGGATGG + Intergenic
1110505488 13:76280993-76281015 GATGAAAGTTAACATGGAGGAGG - Intergenic
1116906421 14:50408046-50408068 GATAAAAGCTAACATGGGGCCGG - Intronic
1117368750 14:55056473-55056495 GTTAAACCTTAACATGGGAATGG + Intronic
1117680886 14:58201493-58201515 GATGCAAGTAAACATGGAGACGG + Intronic
1122058460 14:99121070-99121092 GATGAACGTGAACAGCGGGGAGG - Intergenic
1124656620 15:31514458-31514480 GATGAAAATAAACATGGAGAGGG - Intronic
1125991699 15:44116080-44116102 GATGAATGCTAACCAGGGGAAGG + Intronic
1126181354 15:45788053-45788075 GAAGAACCATACCATGGGGAGGG + Intergenic
1137908380 16:52349928-52349950 GATGAATTTTAACATGTGCATGG - Intergenic
1146435220 17:32839609-32839631 GATGAAGGGAAGCATGGGGAAGG + Intronic
1146958332 17:36950243-36950265 GATGAAGGGGAAGATGGGGAAGG + Exonic
1147316080 17:39621111-39621133 CATGAAAATTCACATGGGGAGGG - Intergenic
1150288565 17:63968007-63968029 GATGAAGGTAAGAATGGGGAGGG - Exonic
1151221266 17:72614905-72614927 GCTGATTTTTAACATGGGGATGG - Intergenic
1156785244 18:40904751-40904773 GATGAAAGTAAATATGGAGAAGG - Intergenic
1159875783 18:73809372-73809394 GATGAAAGTAAATTTGGGGAGGG - Intergenic
1160977443 19:1800261-1800283 GATGAACATGGACATCGGGATGG + Exonic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1202644959 1_KI270706v1_random:131220-131242 TATGAACAATATCATGGGGAGGG - Intergenic
939673498 2:145043058-145043080 AATGAAAGAAAACATGGGGAGGG - Intergenic
945953144 2:216059264-216059286 GATGAGTGTTTACCTGGGGATGG - Intronic
946651779 2:221899209-221899231 GATGAATACTAAGATGGGGAAGG - Intergenic
1169710848 20:8561627-8561649 GAGGAAAGTTAATGTGGGGAGGG - Intronic
1173242180 20:41306887-41306909 GAAGAGCCTTAACATGGGAAAGG + Intronic
1176606920 21:8841447-8841469 TATGAACAATATCATGGGGAGGG + Intergenic
1180357000 22:11851224-11851246 TATGAACAATATCATGGGGAGGG + Intergenic
1180381262 22:12141107-12141129 TATGAACAATATCATGGGGAGGG - Intergenic
1181830427 22:25556113-25556135 GATGAACATTAAAATAAGGAAGG - Intergenic
1181894600 22:26095959-26095981 GATGAACATTTACATGGCAAGGG + Intergenic
954549869 3:51472313-51472335 GATGAACGGTTACTTGGGGCAGG - Intronic
961493538 3:127274262-127274284 GATGCAGTTTAACATAGGGAGGG - Intergenic
963222227 3:142825344-142825366 GATGACAGTTAAGATGAGGAGGG - Intronic
964603284 3:158528274-158528296 AATGAACACTAAAATGGGGAAGG + Intronic
968352641 3:198073011-198073033 GATCAAAGTTAACGTGGGGAGGG - Intergenic
973371179 4:49249634-49249656 TATGAACAATATCATGGGGAGGG - Intergenic
973389825 4:49545677-49545699 TATGAACAATATCATGGGGAAGG + Intergenic
973990996 4:56407261-56407283 GATGATCATTAATATGGGGAGGG - Intronic
977406012 4:96599657-96599679 GAAGAATATTAACATGTGGAAGG - Intergenic
978655492 4:111061154-111061176 CCTGACCCTTAACATGGGGAAGG - Intergenic
979145776 4:117246160-117246182 GATGAAAGTTAACATGGGAAGGG - Intergenic
980724104 4:136735726-136735748 GATGAACGTTAGCATGGGGAGGG + Intergenic
982516160 4:156352567-156352589 GATGAACGTTAAGAATGGTAAGG - Intergenic
985089173 4:186345998-186346020 GATGATCGTGGAGATGGGGAGGG - Intergenic
986508858 5:8481473-8481495 AATGGACGTTAAGTTGGGGAGGG - Intergenic
995103617 5:108347672-108347694 GAAGAAGGGTAAAATGGGGAGGG + Intronic
995150034 5:108832359-108832381 GATGCAGGTTAAGATGTGGATGG + Intronic
996909676 5:128640843-128640865 GATGAACGTTAACATGGGGAAGG + Intronic
998525001 5:142834616-142834638 GATGAAAGACTACATGGGGAGGG - Intronic
1002084288 5:176762097-176762119 GTTGAATGTTACCTTGGGGAGGG + Intergenic
1006951482 6:37824855-37824877 GATGTACTTTAAGATAGGGATGG + Intronic
1027340520 7:77202914-77202936 GAGGAAAGATAACATGGGGAGGG + Intronic
1028684633 7:93577444-93577466 GGTGGATGTTAACATGGGGATGG + Intergenic
1028717980 7:93995747-93995769 GATAAACGTTAACAAATGGAAGG + Intronic
1030195793 7:106852325-106852347 CATGAGCGTTAACCTGGGTATGG + Intergenic
1030288704 7:107850936-107850958 AATGAACTTTAACATGGGTGAGG + Intergenic
1033132637 7:138758204-138758226 GATGCACAGTAATATGGGGAGGG + Intronic
1038832554 8:31077547-31077569 GATGAACTTTAAAATGGGGAAGG + Intronic
1042572653 8:70183751-70183773 GGGGAATGTTAAGATGGGGATGG - Intronic
1044121587 8:88403633-88403655 GATGAAGGTTAACATGTGAGGGG - Intergenic
1044190199 8:89307124-89307146 GAAGAACGTTGAGATGGGGTAGG - Intergenic
1045740557 8:105353729-105353751 GATAAACGTTAATATGAAGATGG - Intronic
1046634518 8:116658930-116658952 GATCAATGTTTACATGGCGAAGG + Exonic
1046795121 8:118363353-118363375 GAAGACCATTGACATGGGGAGGG - Intronic
1051812087 9:21060730-21060752 GCTTAACATTTACATGGGGATGG - Intergenic
1055753303 9:79530575-79530597 GAAGAGCATTCACATGGGGAAGG + Intergenic
1061705945 9:132453201-132453223 GCTGAACGTTAAATTTGGGAAGG - Intronic
1203695605 Un_GL000214v1:94578-94600 TATGAACAATATCATGGGGAGGG - Intergenic
1203742058 Un_GL000218v1:11737-11759 TATGAACAATATCATGGGGAGGG + Intergenic
1203702256 Un_KI270742v1:6327-6349 TATGAACAATATCATGGGGAGGG + Intergenic
1203554235 Un_KI270743v1:192383-192405 TATGAACAATATCATGGGGAGGG + Intergenic
1203640668 Un_KI270751v1:9485-9507 TATGAACAATATCATGGGGAGGG + Intergenic
1186190162 X:7060347-7060369 ATTGAACGTTAATATGGGCATGG - Intronic
1186215892 X:7300853-7300875 GATAAGCATTAAGATGGGGAAGG + Intronic
1186996318 X:15127108-15127130 GATGAAAGTTAACAAGGGTTGGG - Intergenic
1188985837 X:36767684-36767706 GAAGAAGGTGAACATTGGGAAGG - Intergenic
1201155589 Y:11129213-11129235 TATGAACAATATCATGGGGAGGG + Intergenic