ID: 996912233

View in Genome Browser
Species Human (GRCh38)
Location 5:128668983-128669005
Sequence AACAGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996912229_996912233 4 Left 996912229 5:128668956-128668978 CCACAGATAATTATTCTTCTTTC 0: 1
1: 0
2: 7
3: 167
4: 953
Right 996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG No data
996912226_996912233 15 Left 996912226 5:128668945-128668967 CCTGCCATCACCCACAGATAATT 0: 1
1: 0
2: 40
3: 1517
4: 22512
Right 996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG No data
996912227_996912233 11 Left 996912227 5:128668949-128668971 CCATCACCCACAGATAATTATTC 0: 1
1: 0
2: 2
3: 45
4: 722
Right 996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG No data
996912228_996912233 5 Left 996912228 5:128668955-128668977 CCCACAGATAATTATTCTTCTTT 0: 1
1: 0
2: 1
3: 62
4: 629
Right 996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG No data
996912225_996912233 16 Left 996912225 5:128668944-128668966 CCCTGCCATCACCCACAGATAAT 0: 1
1: 1
2: 4
3: 63
4: 540
Right 996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996912233 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG Intronic
No off target data available for this crispr