ID: 996916294

View in Genome Browser
Species Human (GRCh38)
Location 5:128715624-128715646
Sequence GAGGACCAGCAAGTAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996916294_996916296 -2 Left 996916294 5:128715624-128715646 CCAGTATTTACTTGCTGGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 201
Right 996916296 5:128715645-128715667 TCTCCTGCAAGTCTTTACTCAGG 0: 1
1: 0
2: 0
3: 28
4: 163
996916294_996916297 -1 Left 996916294 5:128715624-128715646 CCAGTATTTACTTGCTGGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 201
Right 996916297 5:128715646-128715668 CTCCTGCAAGTCTTTACTCAGGG No data
996916294_996916299 16 Left 996916294 5:128715624-128715646 CCAGTATTTACTTGCTGGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 201
Right 996916299 5:128715663-128715685 TCAGGGTTAACTATTTTGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996916294 Original CRISPR GAGGACCAGCAAGTAAATAC TGG (reversed) Intronic
901403056 1:9027460-9027482 GAGGAGCAGCAAACAAACACTGG - Intergenic
905620491 1:39441340-39441362 GGTGACCACCAAGGAAATACAGG + Intronic
906395199 1:45456896-45456918 GAGGACTAGTGAGGAAATACTGG + Intronic
906790488 1:48654859-48654881 GAGGACCAACAAATAAATTAGGG - Intronic
908479605 1:64525457-64525479 GAGAACCAGCATGTCAAAACTGG - Intronic
910894068 1:92049229-92049251 CAGGAACAGCAAGTAGATCCTGG - Intronic
912797809 1:112703464-112703486 GAGAACCAGAAAGTATATCCAGG + Intronic
913723394 1:121624693-121624715 GAGGACCTGCAAGTGGATATTGG - Intergenic
913725226 1:121646181-121646203 GAGGACCTGCAAGTGGATATTGG - Intergenic
913725391 1:121648047-121648069 GAGGACCTGCAAGTGGATATTGG - Intergenic
913725556 1:121649912-121649934 GAGGACCTGCAAGTGGATATTGG - Intergenic
913725724 1:121651778-121651800 GAGGACCTGCAAGTGGATATTGG - Intergenic
913725889 1:121653644-121653666 GAGGACCTGCAAGTGGATATTGG - Intergenic
913726053 1:121655508-121655530 GAGGACCTGCAAGTGGATATTGG - Intergenic
913726219 1:121657374-121657396 GAGGACCTGCAAGTGGATATTGG - Intergenic
913726384 1:121659240-121659262 GAGGACCTGCAAGTGGATATTGG - Intergenic
913726547 1:121661106-121661128 GAGGACCTGCAAGTGAATATTGG - Intergenic
913726711 1:121662971-121662993 GAGGACCTGCAAGTGGATATTGG - Intergenic
913726875 1:121664836-121664858 GAGGACCTGCAAGTGAATATTGG - Intergenic
913731461 1:121718940-121718962 GAGGACCTGCAAGTGGATATTGG - Intergenic
913731765 1:121722671-121722693 GAGGACCTGCAAGTGGATATTGG - Intergenic
913732225 1:121728268-121728290 GAGGACCTGCAAGTGGATATTGG - Intergenic
913732379 1:121730133-121730155 GAGGACCTGCAAGTGGATATTGG - Intergenic
913732531 1:121731998-121732020 GAGGACCTGCAAGTGGATATTGG - Intergenic
913737162 1:121798114-121798136 GAGGACCTGCAAGTGGATATTGG - Intergenic
913737411 1:121800950-121800972 GAGGACCTGCAAGTGGATATTGG - Intergenic
913737575 1:121802815-121802837 GAGGACCTGCAAGTGGATATTGG - Intergenic
913739210 1:121821632-121821654 GAGGACCTGCAAGTGGATATTGG + Intergenic
913739380 1:121823496-121823518 GAGGACCTGCAAGTGGATATTGG + Intergenic
913743077 1:121870802-121870824 GAGGACCTGCAAGTGGATATTGG - Intergenic
913743237 1:121872658-121872680 GAGGACCTGCAAGTGGATATTGG - Intergenic
913743353 1:121873762-121873784 GAGGACCTGCAAGTGGATATTGG - Intergenic
913743687 1:121877485-121877507 GAGGACCTGCAAGTGGATATTGG - Intergenic
913744330 1:121884952-121884974 GAGGACCTGCAAGTGGATATTGG - Intergenic
913744627 1:121888683-121888705 GAGGACCTGCAAGTGGATATTGG - Intergenic
913744795 1:121890549-121890571 GAGGACCTGCAAGTGGATATTGG - Intergenic
913746484 1:121911350-121911372 GAGGACCTGCAAGTGGATATTGG - Intergenic
913746664 1:121913551-121913573 GAGGACCTGCAAGTGGATATTGG - Intergenic
913747565 1:121924007-121924029 GAGGACCTGCAAGTGGATATTGG - Intergenic
913747788 1:121926198-121926220 GAGGACCTGCAAGTGGATATTGG - Intergenic
913748129 1:121929972-121929994 GAGGACCTGCAAGTGGATATTGG - Intergenic
913749869 1:121951276-121951298 GAGGACCTGCAAGTGGATATTGG - Intergenic
913751880 1:122027221-122027243 GAGGACCTGCAAGTGGATATTGG + Intergenic
913752196 1:122030954-122030976 GAGGACCTGCAAGTGGATATTGG + Intergenic
913752510 1:122034687-122034709 GAGGACCTGCAAGTGGATATTGG + Intergenic
913752676 1:122036554-122036576 GAGGACCTGCAAGTGGATATTGG + Intergenic
913753007 1:122040289-122040311 GAGGACCTGCAAGTGGATATTGG + Intergenic
913754151 1:122053694-122053716 GAGGACCTGCAAGTGGATATTGG + Intergenic
913754476 1:122057511-122057533 GAGGACCTGCAAGTGGATATTGG + Intergenic
913755601 1:122070574-122070596 GAGGACCTGCAAGTGGATATTGG + Intergenic
913755759 1:122072439-122072461 GAGGACCTGCAAGTGGATATTGG + Intergenic
913756071 1:122076171-122076193 GAGGACCTGCAAGTGGATATTGG + Intergenic
913756232 1:122078037-122078059 GAGGACCTGCAAGTGGATATTGG + Intergenic
913756552 1:122081768-122081790 GAGGACCTGCAAGTGGATATTGG + Intergenic
913757045 1:122087539-122087561 GAGGACCTGCAAGTGGATATTGG + Intergenic
913757526 1:122093137-122093159 GAGGACCTGCAAGTGGATATTGG + Intergenic
913758013 1:122098738-122098760 GAGGACCTGCAAGTGGATATTGG + Intergenic
913758176 1:122100603-122100625 GAGGACCTGCAAGTGGATATTGG + Intergenic
913758864 1:122108613-122108635 GAGGACCTGCAAGTGGATATTGG + Intergenic
913759376 1:122114469-122114491 GAGGACCTGCAAGTGGATATTGG + Intergenic
913760379 1:122126005-122126027 GAGGACCTGCAAGTGGATATTGG + Intergenic
913760701 1:122129739-122129761 GAGGACCTGCAAGTGGATATTGG + Intergenic
913760868 1:122131605-122131627 GAGGACCTGCAAGTGGATATTGG + Intergenic
913761026 1:122133469-122133491 GAGGACCTGCAAGTGGATATTGG + Intergenic
913761991 1:122144668-122144690 GAGGACCTGCAAGTGGATATTGG + Intergenic
913762324 1:122148399-122148421 GAGGACCTGCAAGTGGATATTGG + Intergenic
913762645 1:122152130-122152152 GAGGACCTGCAAGTGGATATTGG + Intergenic
913764251 1:122170792-122170814 GAGGACCTGCAAGTGGATATTGG + Intergenic
913764596 1:122174731-122174753 GAGGACCTGCAAGTGGATATTGG + Intergenic
913765233 1:122182196-122182218 GAGGACCTGCAAGTGGATATTGG + Intergenic
913765655 1:122187285-122187307 GAGGACCTGCAAGTGGATATTGG + Intergenic
913765819 1:122189150-122189172 GAGGACCTGCAAGTGGATATTGG + Intergenic
913767442 1:122207990-122208012 GAGGACCTGCAAGTGGATATTGG + Intergenic
913767599 1:122209856-122209878 GAGGACCTGCAAGTGGATATTGG + Intergenic
913767759 1:122211722-122211744 GAGGACCTGCAAGTGGATATTGG + Intergenic
913768415 1:122219191-122219213 GAGGACCTGCAAGTGGATATTGG + Intergenic
913768571 1:122221056-122221078 GAGGACCTGCAAGTGGATATTGG + Intergenic
913768731 1:122222926-122222948 GAGGACCTGCAAGTGGATATTGG + Intergenic
915650990 1:157310768-157310790 CAGGGCCAGCAAGTTACTACTGG + Intergenic
915660434 1:157400791-157400813 CAGGGCCAGCAAGTTACTACTGG - Intergenic
916496466 1:165352670-165352692 GAGAACCAGCAAGGAGACACGGG + Intronic
919070077 1:192743462-192743484 TAGGACTAGGAATTAAATACAGG + Intergenic
922534572 1:226370423-226370445 GAGGTCCAGCAGGTAAGCACAGG - Exonic
1063362190 10:5467876-5467898 GGGGCCCAGCAAGTAAAGAATGG - Intergenic
1066585629 10:36931486-36931508 GAGGACCAGAAGGAAAATAAGGG + Intergenic
1067074673 10:43170043-43170065 GAGGACCTGAGAGTAAATAGTGG + Intronic
1067656986 10:48201292-48201314 GAGGTCCAGTAAGTATTTACTGG + Exonic
1079484498 11:20921057-20921079 AAGGACCAGCTAGTAAATTTTGG + Intronic
1081246646 11:40775108-40775130 GTGGACAAGAAAGTAAATATTGG + Intronic
1081477521 11:43449069-43449091 GAGGACCAGCTAGGAAGTACTGG - Intronic
1085902504 11:80718383-80718405 GAGGACCAGAAAGAAAATAGAGG - Intergenic
1086240140 11:84680454-84680476 GAGGACCAGCATGTAAGGATAGG - Intronic
1087317521 11:96621155-96621177 GAGGACAAGAAAATAAAGACAGG - Intergenic
1092848509 12:12606041-12606063 GAAGAGCAGCAAGTAGAAACTGG - Intergenic
1093896441 12:24579925-24579947 GATGACCAGCAACCAAATGCTGG + Intergenic
1096085591 12:48863165-48863187 TAAGACTAGCAAGTAAATAATGG + Intronic
1097892107 12:64787642-64787664 GAAGAGAAGCAAGAAAATACAGG - Intronic
1100707129 12:97213026-97213048 GAGGACCAGCAGGTGAACATAGG + Intergenic
1100899280 12:99219941-99219963 GAGTACCAACAAGGACATACTGG + Intronic
1102722819 12:115032854-115032876 GCAGACCAGCAAATGAATACAGG + Intergenic
1102790406 12:115639694-115639716 GAGGACCAGGGAGTAATTCCTGG + Intergenic
1105757401 13:23480901-23480923 GAGGAACAGAAAGAAAAAACAGG - Intergenic
1112747210 13:102540099-102540121 GAGGACCTAGAAATAAATACAGG - Intergenic
1113698124 13:112363175-112363197 GAAGACTAGCAAGAAAATGCAGG - Intergenic
1116572965 14:46541455-46541477 GAGGATAATTAAGTAAATACTGG - Intergenic
1118934700 14:70276561-70276583 AAGGACCAGAAAGGAAATAAAGG + Intergenic
1202942063 14_KI270725v1_random:159406-159428 TAGGGCCAGCAACAAAATACAGG + Intergenic
1124010786 15:25836896-25836918 GTGGACCTGAAGGTAAATACTGG - Intronic
1125106264 15:35975131-35975153 GAGGACCTGAGAGTAAATTCAGG - Intergenic
1126291367 15:47084060-47084082 TAGGGCCAGCAACAAAATACAGG - Intergenic
1127106691 15:55623973-55623995 GGTGACCACCCAGTAAATACAGG + Intronic
1128525052 15:68406711-68406733 GAGGTCCAGCTCGTAGATACTGG + Intronic
1129692126 15:77719556-77719578 GAGGCCCAGCAAGCATATGCCGG - Intronic
1135775348 16:25253227-25253249 GGGGGTAAGCAAGTAAATACAGG + Intronic
1136278006 16:29190991-29191013 GAGGCCCAGCAAGGAAACCCAGG - Intergenic
1142082379 16:88157031-88157053 GAGGCCCAGCAAGGAAACCCCGG - Intergenic
1142900835 17:3010554-3010576 GTGGTCCAGCAGCTAAATACAGG + Intronic
1143611769 17:8022072-8022094 GAGGACCAGCCAGTCCATGCAGG - Intergenic
1145299172 17:21618869-21618891 GAGGAAGAGAAAGTAAATATGGG + Intergenic
1145351107 17:22084413-22084435 GAGGAAGAGAAAGTAAATATGGG - Intergenic
1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG + Intronic
1146539481 17:33681933-33681955 GAGGGGCAGAAAGTTAATACAGG - Intronic
1146832153 17:36079455-36079477 GAAGGCCAGATAGTAAATACTGG + Intergenic
1148150486 17:45394121-45394143 GAGGAGCAGACAATAAATACCGG + Exonic
1149288606 17:55193752-55193774 GAGGCCCAGGAAGTAAATGATGG - Intergenic
1150234389 17:63581181-63581203 GAGGACCAGTAAGGAACTTCTGG + Intronic
1151128572 17:71872079-71872101 GAAGACCAGTAAGTAGAAACTGG - Intergenic
1159430968 18:68352816-68352838 GAGGACAAGAATGTAAATACAGG - Intergenic
1159484796 18:69042130-69042152 GAGGAGCAGCATGGAAAAACTGG + Intronic
1159968661 18:74621902-74621924 GAGGACTAGCACATAAACACTGG - Intronic
1160201145 18:76796360-76796382 GAGGACCAGCAAGGAACTGATGG - Intronic
1161017435 19:1990277-1990299 GAGGACCAGCAGTTAAAGCCGGG + Intronic
1162259520 19:9521081-9521103 GAGGCCCAGCCAGAAAATAAGGG + Intergenic
1164811871 19:31163845-31163867 GAAGAGCTGCAAGTATATACTGG + Intergenic
1168700211 19:58433912-58433934 CAGCACCAGAAAGTACATACTGG - Exonic
928502851 2:31915369-31915391 GAGGAGTAGCATGTATATACAGG - Intronic
937585681 2:123545886-123545908 GAGGACAAGATAGTAAAAACAGG - Intergenic
946649239 2:221872998-221873020 CAGGAGCAGCAGATAAATACTGG + Intergenic
946713097 2:222526250-222526272 GAGGCACAGCATGCAAATACAGG - Intronic
946734594 2:222741710-222741732 CAGTACCAGGAAGTAAACACTGG - Intergenic
948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG + Intronic
1171171946 20:23023394-23023416 GAGCACCAGCAAGTGAATGAGGG + Intergenic
1171442962 20:25180543-25180565 CAGGACCAACATGTACATACAGG - Intergenic
1171537983 20:25914545-25914567 TAGGGCCAGCAACAAAATACAGG + Intergenic
1171561355 20:26129389-26129411 GAGGAAGAGAAAGTAAATATGGG - Intergenic
1171840916 20:30209862-30209884 CAGGGCCAGCAACAAAATACAGG + Intergenic
1172372286 20:34403873-34403895 GAGGAACAGCAAATAACTAAGGG + Intronic
1172548064 20:35777207-35777229 GAGAACTGACAAGTAAATACGGG - Intronic
1176581107 21:8527528-8527550 TAGGGCCAGCAACAAAATACAGG - Intergenic
1176649891 21:9535906-9535928 GAGGAAGAGAAAGTAAATATGGG + Intergenic
1184951011 22:47842594-47842616 GAGGCCCAGCAGGAAAAAACTGG + Intergenic
949731206 3:7115452-7115474 CAGGAGCAGCAAGGAGATACTGG - Intronic
951001962 3:17573211-17573233 GAAGACCGGAAAGGAAATACTGG - Intronic
952385178 3:32835945-32835967 AATGACCAGCAAGTCAGTACAGG - Intronic
954244301 3:49318569-49318591 GAGGACCACCTTGTAAATTCTGG - Intronic
955205438 3:56891812-56891834 CAGTAACAGCAAGTAAGTACAGG + Intronic
956409297 3:68962512-68962534 AAGGATCAGCAAGTAAAACCTGG - Intergenic
957504837 3:81106296-81106318 CAGGACCAGCAAATGCATACAGG + Intergenic
959833784 3:110894649-110894671 AAGGGCCAGGCAGTAAATACTGG + Intergenic
960234332 3:115264144-115264166 GAGGACCAGCACATAAAGGCAGG - Intergenic
963857592 3:150271284-150271306 CAGGACCAACAAGAAAATGCTGG + Intergenic
967084138 3:186078892-186078914 AATGACCTCCAAGTAAATACTGG + Intronic
969432625 4:7164806-7164828 GAAAACCAGGAAGGAAATACCGG - Intergenic
969989602 4:11248600-11248622 GAGGATAAGCAAGTAAATCAAGG - Intergenic
970668688 4:18370074-18370096 GAAAACTAGCAAGTAAATTCTGG + Intergenic
972560935 4:40228472-40228494 TTGGACCAGCAAGTAAAAGCAGG + Intronic
978797273 4:112720882-112720904 GAGGACCATCAAGGGAATAATGG + Intergenic
980101287 4:128543747-128543769 GATGAGCAGCAAGAAGATACTGG - Intergenic
980220681 4:129909752-129909774 GAGGACCAAAAAATAAATAATGG + Intergenic
983436927 4:167727747-167727769 GATGATTAGCAAGCAAATACTGG + Intergenic
984807822 4:183767584-183767606 GAGGACCAGCATTTCAATAAAGG + Intergenic
986874147 5:12085451-12085473 GAGTAGGAGCAAATAAATACAGG + Intergenic
987970632 5:24939353-24939375 GAGGTCCAGGAAATAAATAAGGG + Intergenic
988286777 5:29228887-29228909 GAGGACCAGAGAGTCAACACTGG + Intergenic
991571187 5:68054990-68055012 AAGGGCCAGCAAGCAACTACAGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992920660 5:81514266-81514288 GAGGACAAAAAAGTAAATAAGGG + Intronic
995092098 5:108189850-108189872 GAGGGCCAGCAAGAAAATAAGGG + Intronic
995491837 5:112701650-112701672 GAGGAGAAGGAAGTAAACACTGG + Intergenic
996916294 5:128715624-128715646 GAGGACCAGCAAGTAAATACTGG - Intronic
1000816947 5:165934745-165934767 GAGTATCATCCAGTAAATACTGG - Intergenic
1002420898 5:179148650-179148672 GAGGACCAGGAAGGAAGCACGGG - Intronic
1004737827 6:18425509-18425531 GAGCAGCAGCAAGGAAATATGGG - Intronic
1005947533 6:30605222-30605244 GAGGACCAGGAAGCACATGCAGG + Intronic
1012957199 6:105583846-105583868 CAGGACGAGCAAGTTAATGCTGG - Intergenic
1014398286 6:120953580-120953602 GAGGGGGAGCAAGGAAATACTGG - Intergenic
1014509497 6:122303661-122303683 TAGGACCAGGATGTAAATCCAGG - Intergenic
1015127857 6:129774339-129774361 GAGGAAAAGCACATAAATACAGG + Intergenic
1023814687 7:43940641-43940663 GAGGACGAGAAAGGATATACAGG - Intronic
1027631370 7:80610040-80610062 AAGGACTGGCAAGTGAATACTGG + Intronic
1028431507 7:90752123-90752145 GAAGACCAACAAGGAAATTCTGG + Intronic
1028998610 7:97129249-97129271 CAGGAGCAGGAAGCAAATACAGG - Intronic
1029225453 7:99024107-99024129 GAGGATCAATAAGGAAATACAGG + Intergenic
1034511059 7:151535185-151535207 AACAACCAGCAAGCAAATACTGG - Intergenic
1045327847 8:101129908-101129930 GAGGAATAGCATGTGAATACAGG - Intergenic
1052226062 9:26087933-26087955 GAGTAACAGGAAGCAAATACTGG + Intergenic
1055404140 9:75956753-75956775 GCGGACCACCAAGAAAATAAGGG - Intronic
1055907540 9:81311485-81311507 GAGAAGCAGCATATAAATACAGG - Intergenic
1057475119 9:95393193-95393215 GAGGACTACCAAGTAACTAGTGG - Intergenic
1060060277 9:120453667-120453689 GAGGCCCAGCTAGTAAAGGCAGG - Exonic
1203547879 Un_KI270743v1:141510-141532 GGGGACCAGTGAGTACATACTGG + Intergenic
1203611122 Un_KI270749v1:5574-5596 TAGGGCCAGCAACAAAATACAGG - Intergenic
1203627633 Un_KI270750v1:39454-39476 GAGGAAGAGAAAGTAAATATGGG + Intergenic
1185686861 X:1936383-1936405 GAAAACCAGAAAGTTAATACAGG + Intergenic
1187573318 X:20528239-20528261 GAGGACCTGAAAGTAAACAAGGG - Intergenic
1189230231 X:39446335-39446357 GGGTACCAGCCAGTAAAAACGGG - Intergenic
1193648738 X:84102848-84102870 GAGGACCAGAAAGGAGATGCTGG + Intronic
1195569381 X:106381696-106381718 GAGCTCCAAAAAGTAAATACTGG - Intergenic
1196051169 X:111306529-111306551 GAAGACCAACAAGTAAATAGAGG + Intronic
1198776346 X:140183508-140183530 GAGTAGCAGCAAGCAAGTACAGG - Intergenic