ID: 996916485

View in Genome Browser
Species Human (GRCh38)
Location 5:128718437-128718459
Sequence TGGTGACTCCTAGTCACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996916483_996916485 -5 Left 996916483 5:128718419-128718441 CCTCAGCCTAGGAGTCTTTGGTG 0: 1
1: 0
2: 2
3: 11
4: 128
Right 996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 80
996916480_996916485 29 Left 996916480 5:128718385-128718407 CCTGAGGTTTTGCACATTGAACA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996916485 Original CRISPR TGGTGACTCCTAGTCACCAA AGG Intronic
902842361 1:19083101-19083123 TACTGACACCTAGTCACCCAGGG + Intronic
904565735 1:31427216-31427238 TGGTGATTCCTAGACACCTCTGG + Intronic
911321665 1:96421018-96421040 TGGTGACATTTATTCACCAAAGG + Intergenic
911631760 1:100191609-100191631 GGCTGACTCCTAGGCTCCAAAGG + Exonic
918570434 1:185984823-185984845 TGGTTACTGTTAGTCACGAATGG - Intronic
919317209 1:195987016-195987038 TGGTGAGTCCTAGAATCCAAAGG - Intergenic
921031691 1:211339999-211340021 TGGTGACTTTTAGCTACCAAAGG - Intronic
1063659408 10:8023567-8023589 TGGTAGCTCCTAGCCACCAGTGG - Intergenic
1071180213 10:82975464-82975486 GAGTGACTCCTAGACACCATAGG - Intronic
1071334688 10:84591082-84591104 TGGTGGCTCCTGCTCACCAGAGG + Intergenic
1073629800 10:105137053-105137075 TGGGGTTTCCAAGTCACCAACGG - Intronic
1074076773 10:110134677-110134699 TGGTGACTCATATTCACGATAGG + Intronic
1074534600 10:114319877-114319899 ATGTGACTACTTGTCACCAAGGG + Intronic
1074911388 10:117912522-117912544 AGGTGACTGCTAGGCACAAAAGG + Intergenic
1075851450 10:125591389-125591411 TGGTGGCTCCCAGTTACTAAGGG - Intronic
1080659195 11:34282220-34282242 TGTTGATACCTAATCACCAATGG - Intronic
1084941543 11:72615877-72615899 AGGGGGCTCCTAGTCCCCAAGGG + Intronic
1088408501 11:109507368-109507390 TGGTGCCACCCAGTCACCAAAGG + Intergenic
1092276947 12:7068565-7068587 AGGTGACTCCCAGTCACCCATGG - Intronic
1092525599 12:9307942-9307964 TGGTGACTCCTACCTAGCAAAGG + Intergenic
1098074855 12:66718210-66718232 TGCTGACTCTAAGTCACCACTGG + Intronic
1099829191 12:87818013-87818035 TGGTGGCTGCTGGCCACCAATGG - Intergenic
1100340675 12:93676830-93676852 TAGTTACTCCTAGTCAGAAAGGG - Intergenic
1101828887 12:108242001-108242023 GGGTGATTCATAGCCACCAATGG - Intronic
1102024707 12:109707706-109707728 GGGTAACTCCTGGTCAACAATGG + Intergenic
1107247178 13:38310282-38310304 TGGTGACTCTTAGTCAGCTCAGG + Intergenic
1113527346 13:110991628-110991650 TGGTGACTCCTACACTCCAATGG - Intergenic
1113713213 13:112484444-112484466 TGGTGACTCCTACACTCCAATGG + Intergenic
1115018950 14:28651276-28651298 TTGTGACTCATACTCAGCAATGG - Intergenic
1120815894 14:88857841-88857863 TGCTAACTCCTAACCACCAAGGG - Intronic
1122045178 14:99017864-99017886 TGGAGACTCCTAGCCAGCAAGGG + Intergenic
1123477383 15:20599270-20599292 TGGGGCCTCCTCCTCACCAAGGG + Intergenic
1123640633 15:22401112-22401134 TGGGGCCTCCTCCTCACCAAGGG - Intergenic
1131304983 15:91234424-91234446 TGGTGGCACTCAGTCACCAAAGG + Intronic
1135983762 16:27168667-27168689 TTTTGACTTCTAGTGACCAAAGG - Intergenic
1137636266 16:49989314-49989336 TGGTGGCTGCCAGTGACCAAAGG + Intergenic
1140348086 16:74234259-74234281 TGTTGAAACCTAATCACCAAGGG + Intergenic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1144261695 17:13527827-13527849 TGGGGACTTCAAGTCACAAAAGG + Intronic
1152927750 17:83095368-83095390 TGGTGACCCCATGTCCCCAAAGG + Intergenic
1154232280 18:12567999-12568021 TGGTGGCACTCAGTCACCAAAGG - Intronic
1157479100 18:48041358-48041380 TGGTGTCAGCTACTCACCAAAGG + Intronic
1163457731 19:17418258-17418280 TGGTGACCCCAAGAAACCAAAGG - Intronic
1165381524 19:35484899-35484921 TCGTGACTCCTAGTCCCCTGGGG + Intergenic
1166319142 19:42005746-42005768 GGGGGACTCCTCGACACCAAGGG - Exonic
1168210029 19:54883597-54883619 TGGTGAGTCCTTCTCAGCAAGGG + Intronic
925148368 2:1598362-1598384 TGCTGACTCCTAGCCAACGAGGG + Intergenic
926401850 2:12505085-12505107 AGGTGACTCCAACTCACCATGGG + Intergenic
934168290 2:89317004-89317026 TTGTGACTGCTAGTCTCCCAGGG + Intergenic
934198997 2:89865578-89865600 TTGTGACTGCTAGTCTCCCAGGG - Intergenic
943580930 2:189682945-189682967 TGTTGAAACCTAATCACCAATGG + Intronic
943742676 2:191427249-191427271 TGGGTACTCCTAGTCACTACTGG - Intergenic
944335072 2:198523172-198523194 TGGAGACTGCTAGTCACTTAAGG + Intronic
946866717 2:224047544-224047566 TGTTGAAACTTAGTCACCAATGG + Intergenic
1181568434 22:23753274-23753296 TGGAGACTCCCAGTCCCAAAGGG + Intronic
1182453321 22:30433894-30433916 TGGTGAGTCATGTTCACCAAAGG + Intergenic
949302803 3:2604311-2604333 TTGTGTATCCTAGTCACCAGAGG + Intronic
958510646 3:95043211-95043233 TTTTGCCTCCTAGTCACCTAGGG + Intergenic
964969155 3:162538788-162538810 GGGTGACCCCTAGTAACCACAGG + Intergenic
965265470 3:166537338-166537360 TGTTGAAACCTAGTCCCCAATGG - Intergenic
968046217 3:195625051-195625073 TGGGGACTCCAGGCCACCAAAGG + Intergenic
968308436 3:197665036-197665058 TGGGGACTCCAGGCCACCAAAGG - Intergenic
968591135 4:1460170-1460192 TGGGGAGTCCTGGTCAGCAAGGG + Intergenic
972948917 4:44294314-44294336 TGGTGGCTCATAGGCACCAGCGG - Intronic
975045127 4:69793754-69793776 TGGTGGATACTAGTCACCTATGG - Intergenic
976916152 4:90376930-90376952 TGGTTACTGCCAGTCATCAAAGG + Intronic
980171161 4:129291972-129291994 TCGTGACTCCTTGCCAGCAAGGG - Intergenic
981028090 4:140096142-140096164 GGCAGACTCCTAGACACCAACGG + Intronic
981597142 4:146438593-146438615 TGGTAACTCCTAGTCTTAAAGGG - Intronic
985747094 5:1653824-1653846 TGGGGACTCCAGGCCACCAAAGG - Intergenic
987493023 5:18605343-18605365 ATGTGACTCACAGTCACCAAAGG - Intergenic
989591558 5:43117815-43117837 TTGGGACTCCTAGTCCCAAATGG - Intronic
990046498 5:51439093-51439115 TCATGACTCCTTGTCTCCAATGG + Intergenic
996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG + Intronic
1001229946 5:169977981-169978003 CGGCCACTCCTAGTCTCCAAAGG + Intronic
1006884080 6:37365691-37365713 TGATGTGTCCTAGCCACCAATGG - Intronic
1014538636 6:122648056-122648078 TGGTGAATCCTGATTACCAAGGG - Intronic
1019393253 7:801924-801946 TGGTGTCTCCCAGTTACGAATGG + Intergenic
1022036965 7:26543718-26543740 TGGTGACTGCTAGGCGCCAATGG + Intergenic
1035630647 8:1104429-1104451 CCGTGACTTCTTGTCACCAAAGG - Intergenic
1041103499 8:54419397-54419419 GGGAGAGTCCTGGTCACCAAGGG - Intergenic
1045072000 8:98516392-98516414 TGATGACTACTAGACACCCAAGG + Intronic
1048461632 8:134626112-134626134 TTGTGACTCTTAATGACCAAAGG - Intronic
1048834918 8:138509967-138509989 TGTTGAATCCTAGTCATCAGTGG - Intergenic
1051020975 9:12542361-12542383 TTGTTACTCTTAGTCCCCAAGGG + Intergenic
1060597225 9:124855849-124855871 TGGTGCCTGCAGGTCACCAACGG + Exonic
1189171877 X:38917037-38917059 TGGTGACTCTCATTTACCAAAGG - Intergenic
1190962353 X:55264999-55265021 TTGTGGCTCCTAGTCAACAGAGG - Intronic