ID: 996916485

View in Genome Browser
Species Human (GRCh38)
Location 5:128718437-128718459
Sequence TGGTGACTCCTAGTCACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996916483_996916485 -5 Left 996916483 5:128718419-128718441 CCTCAGCCTAGGAGTCTTTGGTG 0: 1
1: 0
2: 2
3: 11
4: 128
Right 996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 80
996916480_996916485 29 Left 996916480 5:128718385-128718407 CCTGAGGTTTTGCACATTGAACA 0: 1
1: 0
2: 0
3: 7
4: 149
Right 996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996916485 Original CRISPR TGGTGACTCCTAGTCACCAA AGG Intronic