ID: 996919378

View in Genome Browser
Species Human (GRCh38)
Location 5:128749786-128749808
Sequence CAGTGTCCCAAAGGGGGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996919370_996919378 12 Left 996919370 5:128749751-128749773 CCTTCCTTTTGGTTACTGTGTGG 0: 1
1: 0
2: 1
3: 20
4: 223
Right 996919378 5:128749786-128749808 CAGTGTCCCAAAGGGGGACTCGG No data
996919372_996919378 8 Left 996919372 5:128749755-128749777 CCTTTTGGTTACTGTGTGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 179
Right 996919378 5:128749786-128749808 CAGTGTCCCAAAGGGGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996919378 Original CRISPR CAGTGTCCCAAAGGGGGACT CGG Intronic
No off target data available for this crispr