ID: 996919704

View in Genome Browser
Species Human (GRCh38)
Location 5:128753487-128753509
Sequence GAAGCTGGGCACTTTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996919704_996919707 9 Left 996919704 5:128753487-128753509 CCTTGCTCAAAGTGCCCAGCTTC 0: 1
1: 0
2: 2
3: 14
4: 209
Right 996919707 5:128753519-128753541 CAGTTTTCTCATACATAACATGG 0: 1
1: 2
2: 71
3: 585
4: 2696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996919704 Original CRISPR GAAGCTGGGCACTTTGAGCA AGG (reversed) Intronic
900563553 1:3320767-3320789 GCAGCTGGGCTGTGTGAGCAGGG - Intronic
902637283 1:17743009-17743031 TAAACTGTGAACTTTGAGCAGGG - Intergenic
904859525 1:33524949-33524971 GAAGCCAGTCACTCTGAGCATGG + Exonic
905279039 1:36837225-36837247 GTGGCTGGGCACTTGGAGGAAGG - Intronic
906510756 1:46409344-46409366 CCAGCTGGGCACATTGAGCCTGG + Intronic
909727970 1:78858459-78858481 CATGCTGGGCACTAAGAGCATGG - Intergenic
910333871 1:86105893-86105915 GAAGCTGGGAACTCTGCACAGGG - Intronic
910750596 1:90626146-90626168 GAAGGTGGCAACTTTGACCAGGG + Intergenic
912119409 1:106452042-106452064 GAAGCTTGTCTCTTTGAGGAAGG - Intergenic
914899619 1:151704887-151704909 GACCCTGGGCACTTGAAGCAGGG - Intronic
915591510 1:156873741-156873763 GAAGCTGGTCTCATTGAGCACGG - Exonic
917507279 1:175639071-175639093 GATGCTGGTTACTTGGAGCAGGG - Intronic
918195675 1:182219154-182219176 GATGCTGGGAAGTTTGAGCTGGG + Intergenic
919641951 1:200053991-200054013 GAAGCTGGGCATGTTCAGTATGG + Intronic
920318541 1:205098330-205098352 AAAGCTGAGCACTCTTAGCATGG + Intronic
922238004 1:223736112-223736134 GAACCGGGGCACTCTGGGCAGGG - Intronic
922503308 1:226111979-226112001 GAAGCAGGGCACTTTGGGTATGG - Intergenic
923441743 1:234027280-234027302 GAAGCTGTGGACTTGGGGCACGG + Intronic
1064293826 10:14059526-14059548 GAAGGTGGCCACCTTAAGCAAGG + Intronic
1066143109 10:32527233-32527255 GAATCTGTGCACTTTGGGGAGGG - Intronic
1068442474 10:57076214-57076236 GAAGCTATGCAATTTGATCAGGG - Intergenic
1068922455 10:62499015-62499037 GAAGCTGGGCACTCTAGCCAAGG - Intronic
1071570327 10:86693127-86693149 CAAGCTGGGGTCTTAGAGCATGG + Intronic
1072492504 10:95921336-95921358 GAATCTGTGCACTTGGAGGAGGG - Intronic
1072901032 10:99407065-99407087 GTAGCTGGTAACTTTGAGCAAGG - Intronic
1073827216 10:107337497-107337519 GAATCTGTGCACTTGGAGGAGGG - Intergenic
1076294801 10:129376055-129376077 GGGGCTGGGCACTTTGACCAAGG - Intergenic
1076731150 10:132439556-132439578 GATTTTGGTCACTTTGAGCACGG - Intergenic
1077091957 11:782641-782663 GAAGCAGGGCACAGTGAGCAAGG - Intronic
1083395302 11:62387245-62387267 GACGCTGGGCAGTTTGAGTTAGG - Intronic
1084002262 11:66302785-66302807 AATCCTGGGCACTTGGAGCAAGG - Intergenic
1085416843 11:76324212-76324234 CAAGCTGGGCAGTCTGAGGAAGG + Intergenic
1086243201 11:84720707-84720729 GAAGCCAGGCACTTAGAGGAGGG + Intronic
1089645937 11:119879016-119879038 GAAGCTGGGGAGGATGAGCAAGG + Intergenic
1090111100 11:123910468-123910490 GAATCTGTGCACTTTGGGGAGGG + Intergenic
1090483973 11:127095539-127095561 GAAACTGGGGACTATGAGAAGGG + Intergenic
1090930330 11:131292188-131292210 GACACTGAGCACTTTGAGGACGG + Intergenic
1091457592 12:619210-619232 CAAGCTGGGCACTTGGGGTAGGG + Intronic
1092798458 12:12138367-12138389 TAAGCTGGGCAATTCGAGCTTGG + Exonic
1095273867 12:40255772-40255794 GAAGCTAGCCACTTTGGGAAAGG + Intronic
1096481084 12:51941467-51941489 GAGGCTGGGCAATCTGAGCCTGG - Intergenic
1096760846 12:53840640-53840662 GAACCTGGGCACTTTGGGGATGG + Intergenic
1098910021 12:76199325-76199347 GAAGCAAGCCCCTTTGAGCAGGG + Intergenic
1099635647 12:85207196-85207218 GAAGCTGGGAACTCTGCACAAGG - Intronic
1100926966 12:99559061-99559083 GAAGCTGGGAACGGTGCGCAGGG - Intronic
1101399205 12:104373380-104373402 GAAGCTGGGGACAATGTGCAAGG - Intergenic
1101563129 12:105879263-105879285 CAGGCTAGGCACTTTGAACAAGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102978723 12:117225125-117225147 GAAGCTGGGTGCTCTGGGCAAGG + Exonic
1105890511 13:24679662-24679684 CATGCTGGGCACTAAGAGCATGG + Intergenic
1106561418 13:30849674-30849696 GAAGGTGGGCAGGTTTAGCAAGG - Intergenic
1110804643 13:79739843-79739865 GAAGCTGGGGGCTTAGAACATGG - Intergenic
1113680840 13:112243795-112243817 GAAGTTGTGCACTCAGAGCAAGG + Intergenic
1113791594 13:113031727-113031749 GGAGCTGGGAGCTTTGAGCCAGG - Intronic
1114538618 14:23438587-23438609 GAGGCAGGGCACTTGGTGCAGGG + Intergenic
1114614218 14:24059753-24059775 GAGGCTGGGGACTTGGATCAGGG - Intronic
1116186984 14:41609759-41609781 GAAGCAGGGCACCCTGAGCTTGG - Intronic
1117384370 14:55195828-55195850 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1121545261 14:94758491-94758513 GCAGCCGGGCAGTTTGGGCAGGG - Intergenic
1121752085 14:96365454-96365476 GAAGCTGGGCAGTTTGGGGGTGG + Intronic
1122310523 14:100791516-100791538 GAAGCAGGGCACTGTGGACATGG + Intergenic
1122626887 14:103089509-103089531 GAGGCTGGGCTCTGCGAGCAGGG - Intergenic
1123476267 15:20594166-20594188 GATGCTGGGCTCTTTGGACAAGG - Intergenic
1123641745 15:22406198-22406220 GATGCTGGGCTCTTTGGACAAGG + Intergenic
1125277116 15:38004708-38004730 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1125680059 15:41524894-41524916 CAAGCTTGGGACCTTGAGCAAGG + Intronic
1128320515 15:66690552-66690574 GAAGAGGGGCTCTTTGAGCTGGG - Intergenic
1128614562 15:69099088-69099110 GAAGCTGGAAACTTGGAGCCTGG + Intergenic
1129373172 15:75110488-75110510 GATGCTGGTCACTAAGAGCAGGG + Intronic
1129667525 15:77587854-77587876 GGGGCTGGTCATTTTGAGCAGGG + Intergenic
1135706917 16:24683063-24683085 GAAGCTTGGAACTGAGAGCAAGG + Intergenic
1136659977 16:31749180-31749202 GAAGCTGTGCACAGTGAGAAAGG + Intronic
1138212150 16:55172634-55172656 GGCACTGGGCACTTTGAGCATGG + Intergenic
1142409359 16:89908189-89908211 GAAGGTGGGAACTTGGAGGAGGG - Intronic
1143434116 17:6909814-6909836 GAAGCTGGGAACCCTGAACAGGG - Intronic
1146951954 17:36912940-36912962 GAAGCTGGGCACTTAGAGGATGG - Intergenic
1147403189 17:40193077-40193099 CAAGCTGGGCACTTGGAGGAAGG - Intronic
1149620466 17:58041039-58041061 CAGGCTGGGCACTTAGAGGAGGG + Intergenic
1150296273 17:64009419-64009441 GAGGATGGGCACTTTGAGTTAGG + Intronic
1153465791 18:5386652-5386674 AAAGCTGGGAACTTTGATAATGG + Intergenic
1155142644 18:23056693-23056715 GAAGCTAAGCACTTTGAACATGG + Intergenic
1156557421 18:38083178-38083200 GAAGCTGAGCAATGTGATCAAGG + Intergenic
1158398040 18:57095009-57095031 GAACTTGAGCCCTTTGAGCAGGG - Intergenic
1159808351 18:72983353-72983375 GAAGCTGGGCATTTTGTGTTAGG + Intergenic
1163836584 19:19578606-19578628 GAAGCCTGGCAGTTTGAGGAGGG - Intronic
1164600995 19:29563087-29563109 GAAGCTGTGCAGTTTAGGCAGGG + Intronic
1166151127 19:40876618-40876640 GAAGCTGGGGTCTCTCAGCACGG + Exonic
1168102014 19:54146313-54146335 GTAGCTGGCCACCTTGGGCAGGG + Intronic
1168316970 19:55488753-55488775 AAGGCTGGGCAGATTGAGCAGGG - Intronic
928715789 2:34058739-34058761 AAAGAGGGGCACGTTGAGCAAGG - Intergenic
932305979 2:70704568-70704590 GTAGCTGGGGACCCTGAGCATGG - Intronic
932824195 2:74925100-74925122 GAGGCTGGGACATTTGAGCAGGG - Intergenic
933553162 2:83800888-83800910 GAAGCTGTACCCTTTGAACAGGG - Intergenic
935028835 2:99303076-99303098 AAGGCAGGGCACTGTGAGCAAGG + Intronic
935492133 2:103734073-103734095 GAAGCTGGGAACCCTGAACAAGG - Intergenic
936789266 2:116131494-116131516 GAAACTGGGCACTAGGTGCATGG + Intergenic
937613674 2:123893924-123893946 GAATCTGTGCACTTTGAAGAGGG - Intergenic
938371154 2:130768985-130769007 GAAGCTGGGAACATTGGGTAGGG + Intergenic
939145738 2:138412540-138412562 GCAGCTGGGCAGCATGAGCAGGG + Intergenic
940004986 2:149002021-149002043 GGAGCTGGGCCTTTGGAGCATGG + Intronic
940586141 2:155653390-155653412 GCAGCTGGACACTTTGTGCATGG - Intergenic
941166691 2:162090571-162090593 GAAACAGGGCACTTACAGCATGG - Intergenic
942377214 2:175349953-175349975 GAAGGTAGCCTCTTTGAGCATGG + Intergenic
942391895 2:175503381-175503403 GAAACTGTGCACTTTGGGGAGGG - Intergenic
943867049 2:192938510-192938532 GAATCTGTGCACTTGGAGAAGGG - Intergenic
943933488 2:193885287-193885309 GAATCTGTGCACTTTGAAGAGGG + Intergenic
944882738 2:204030396-204030418 GAAAATGTGCACTTTCAGCAAGG - Intergenic
949023929 2:241756093-241756115 GAGGCAGGGCAGTTTGACCATGG + Intronic
1169247927 20:4038419-4038441 GGAGCAGGGCTCTGTGAGCAGGG + Intergenic
1169835273 20:9871062-9871084 GATGCTGGGCAATTTGCCCAAGG + Intergenic
1170709364 20:18776146-18776168 GAATCTGTGCACTTAGAGGAGGG - Intergenic
1171462788 20:25308373-25308395 GACGCTGAGCACTTGCAGCAGGG + Intronic
1180016446 21:45088390-45088412 AAAGCGGGTCAATTTGAGCAAGG + Intronic
1180971679 22:19819266-19819288 GAAGCAGGGCCCTGTGAGCTGGG + Intronic
1181284435 22:21741664-21741686 GGAGCTGGGCACCTGGAGGAAGG - Intergenic
949145062 3:690484-690506 GAAGCTGGGAACCTTGTTCAGGG + Intergenic
949483011 3:4511737-4511759 GAACCTGGGCACTTTGACTCTGG + Intronic
951310371 3:21117822-21117844 GAATCTGTGCACTTGGAGGAGGG - Intergenic
952518013 3:34125156-34125178 GAATCTGTGCACTTGGAGGAAGG - Intergenic
953202762 3:40792189-40792211 GAAGCAGTGCCCTTTGAGCCAGG - Intergenic
954447895 3:50556483-50556505 GAAGCTGGGCAGTTTGCGGTAGG - Intergenic
954602266 3:51878764-51878786 GAGGCTGGGCACTTTGGGACTGG + Intergenic
956722396 3:72129803-72129825 AAAGCTTGGCACATTGAGGACGG - Intergenic
957697051 3:83652516-83652538 GAAACTGTGTACTTTGAGCAGGG - Intergenic
959193392 3:103144576-103144598 TAAGCTGGCCAATTTGATCAAGG - Intergenic
960015817 3:112886152-112886174 GAAGCTGGGAACTTTACACAGGG - Intergenic
963975512 3:151475841-151475863 AAAGCTGAACACCTTGAGCAAGG - Intergenic
972810971 4:42585444-42585466 GAAGGTGGGGACTTTGGGAATGG + Intronic
973852658 4:54976740-54976762 GAATCTGTGCACTTTGGGGAGGG + Intergenic
974082621 4:57228397-57228419 AAAAATGGGCAGTTTGAGCAGGG - Intergenic
975489838 4:74976276-74976298 GAAGCTGGGCAGTTTGGACTGGG + Intronic
976564377 4:86537009-86537031 GAAGCTGGGCAGGGTGAGGAGGG + Intronic
978038105 4:104021843-104021865 GTAGTTGGGCACTGTGAGCACGG + Intergenic
980172529 4:129306636-129306658 GAATCTGTGCACTTTGGGGAGGG - Intergenic
982186442 4:152806365-152806387 GTAGGTGGGCACTGTGATCAGGG + Intronic
984098102 4:175456206-175456228 AAAGCTGGGCAGGTTGACCAAGG + Intergenic
986340431 5:6784506-6784528 GAACCAGGGCCCTGTGAGCAGGG + Intergenic
987564181 5:19563899-19563921 GAATCTGTGCACTTTGGGGAGGG + Intronic
988323845 5:29737221-29737243 GAAGCTGGGAACCTTGCACAGGG + Intergenic
989414400 5:41156591-41156613 GAAGTTGGGAACTTTGAGAGCGG + Intronic
989657817 5:43762889-43762911 GAATCTGTGCACTTGGAGGAGGG - Intergenic
990999359 5:61767399-61767421 GCAGCTGGGCAGTTTTGGCATGG + Intergenic
991737911 5:69643913-69643935 GATGCTGGGAGCTCTGAGCACGG - Intergenic
991760283 5:69912511-69912533 GATGCTGGGAGCTCTGAGCACGG + Intergenic
991787049 5:70205589-70205611 GATGCTGGGAGCTCTGAGCACGG - Intergenic
991789487 5:70223639-70223661 GATGCTGGGAGCTCTGAGCACGG - Intergenic
991814235 5:70498749-70498771 GATGCTGGGAGCTCTGAGCACGG - Intergenic
991817370 5:70520041-70520063 GATGCTGGGAGCTCTGAGCACGG - Intergenic
991839514 5:70787562-70787584 GATGCTGGGAGCTCTGAGCACGG + Intergenic
991879494 5:71205979-71206001 GATGCTGGGAGCTCTGAGCACGG - Intergenic
991881934 5:71224008-71224030 GATGCTGGGAGCTCTGAGCACGG - Intergenic
993005281 5:82422877-82422899 GAAGCTGGGGACTTTGGCTAGGG + Intergenic
994330929 5:98505520-98505542 GAAGGTGCTCACTTTGTGCAGGG + Intergenic
994460450 5:100063975-100063997 GATGCTGGGAGCTCTGAGCATGG - Intergenic
994484599 5:100377386-100377408 GATGCTGGGAGCTCTGAGCACGG - Intergenic
994897794 5:105726798-105726820 GAAACTGGGAACTCTGTGCAGGG - Intergenic
996919704 5:128753487-128753509 GAAGCTGGGCACTTTGAGCAAGG - Intronic
998617066 5:143752158-143752180 GAAGCCGGGCACTTGGAGTGGGG - Intergenic
999389848 5:151182085-151182107 GAAGCTGGGGACCTTGAGCAAGG + Exonic
999755170 5:154658794-154658816 GAGGCGGGGCACTTTCGGCATGG - Intergenic
1000730594 5:164829499-164829521 GAAGCTGAGTCCTTTGAGGAAGG + Intergenic
1001184214 5:169552232-169552254 GAAGCTAAGCAATTTGACCAAGG - Intergenic
1001788271 5:174432450-174432472 GAAGCTGGCCACTGTCAGCCCGG - Intergenic
1002052363 5:176578344-176578366 GAACCTGGCCCCTCTGAGCAGGG + Exonic
1002152285 5:177244201-177244223 GAAGCTGGTCACCTGGAGAATGG + Exonic
1002446731 5:179294680-179294702 GAAGCTGGGCACACGGGGCAGGG - Intronic
1002565387 5:180110301-180110323 GAAGCTGGGAACTTTTTGGAGGG - Intronic
1005253872 6:23978947-23978969 GAAGATGGACACTTAGGGCAGGG - Intergenic
1005547724 6:26887055-26887077 GATGCTGGGAGCTCTGAGCACGG - Intergenic
1005633270 6:27729138-27729160 GAAGCTTGGGACTTTAAGCTCGG - Intergenic
1008822650 6:55651914-55651936 GAATCTGTGCACTTTGGGAAGGG - Intergenic
1009018487 6:57928129-57928151 GATGCTGGGAGCTCTGAGCACGG - Intergenic
1009744733 6:67798279-67798301 AAATCTGTGCACTTTGAGGAGGG + Intergenic
1010551744 6:77231796-77231818 GAAACTGGGCATTGTGGGCATGG + Intergenic
1010823629 6:80446499-80446521 TCAGCTGGGCCCTTGGAGCATGG + Intergenic
1013601509 6:111709362-111709384 AAAGCTGGACTCTCTGAGCAAGG + Intronic
1014516830 6:122389231-122389253 GAAGCCTGCCACTTTGAACAGGG + Intergenic
1016446334 6:144136643-144136665 GAATATGAGCACCTTGAGCAAGG + Intergenic
1016898811 6:149080327-149080349 GACGCTGTGTGCTTTGAGCAGGG + Intergenic
1026129160 7:67606188-67606210 CTAGCTGTGCCCTTTGAGCAAGG + Intergenic
1027793902 7:82668163-82668185 GAATCTGGGCATTTTCAGGAAGG + Intergenic
1028406070 7:90475316-90475338 GAAGTTTGGCACATTGAGCAAGG + Intronic
1029277948 7:99418682-99418704 GAATCTGGGCACTCAGAGGAAGG - Exonic
1032292147 7:130598095-130598117 GAAGCTGGGACATTAGAGCAAGG + Intronic
1032864793 7:135914732-135914754 GAAGCTGTTCACTTGGAGGAGGG + Intergenic
1033196259 7:139330018-139330040 CAAGCTGTGCACTCTGGGCAAGG + Intergenic
1034313795 7:150111746-150111768 GAAGCTGGGCTCTCTGGGAAAGG + Intergenic
1034793103 7:153989046-153989068 GAAGCTGGGCTCTCTGGGAAAGG - Intronic
1034841886 7:154405658-154405680 GGAGCTGGGCACTCTGCTCAGGG + Intronic
1038441240 8:27572186-27572208 GAGGCTGGGCAGAGTGAGCATGG + Intergenic
1038442484 8:27581683-27581705 GAAGTTGGGAAGTTTGAGCTGGG - Intergenic
1040571052 8:48611029-48611051 AAAGATGGGCATTTTGATCAAGG + Intergenic
1041580017 8:59447692-59447714 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1042544560 8:69939669-69939691 GAAGCTGGGCAAGTTGTCCAGGG - Intergenic
1042612631 8:70615161-70615183 AAAGCTGGGGTTTTTGAGCAAGG + Intronic
1048638515 8:136326504-136326526 GAAGTTGAGCAATTTGACCAAGG + Intergenic
1049687075 8:143943303-143943325 GGAGCTGGTGACTTTGAGCAGGG + Intronic
1050406160 9:5310394-5310416 GAAACTTGGCAGTTTGGGCAGGG - Intergenic
1051050660 9:12928559-12928581 GAAGCTGGGAACTTTTGGAAAGG - Intergenic
1051145932 9:14027271-14027293 GAGGATGGACACTCTGAGCACGG - Intergenic
1051376943 9:16411642-16411664 GAAGAAAAGCACTTTGAGCAAGG - Exonic
1052205020 9:25828536-25828558 GAATCTGTGCACTTTGGGGAGGG - Intergenic
1055910961 9:81350630-81350652 GAATCTGTGCACTTTGGGGAGGG + Intergenic
1056048551 9:82744585-82744607 GAAGCAGGGTACCTTGACCATGG - Intergenic
1058086287 9:100752047-100752069 GAATCTGTGCACTTGGAGGAGGG - Intergenic
1058939966 9:109803985-109804007 GAAGGTGGGGACTTTCAGGATGG - Intronic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1189695299 X:43656103-43656125 GGAGCTGGGCACTGAGAGCGGGG - Intronic
1190537131 X:51440569-51440591 GAATCTGTGCACTTGGAGGAGGG + Intergenic
1194166522 X:90522612-90522634 GTTTCTGGGCACTTTGAGGAAGG + Intergenic
1195244316 X:102981797-102981819 CAATCTCAGCACTTTGAGCAAGG - Intergenic
1195348721 X:103976788-103976810 GATGCTGAACACTTTTAGCAGGG - Intergenic
1195358721 X:104062052-104062074 GATGCTGAACACTTTTAGCAGGG + Intergenic
1196552415 X:117044998-117045020 GAATCTGTGCACTTTGACAAGGG + Intergenic
1197099678 X:122637426-122637448 GAATCTGTGCACTTAGAGGAGGG - Intergenic
1198559270 X:137830995-137831017 GAATCTGTGCACTTTGGGGAGGG + Intergenic
1199016188 X:142819298-142819320 GAAGCTGGGAACCCTGTGCAGGG + Intergenic
1199325089 X:146489914-146489936 GCAGCTGTGCACTTTGGGGAGGG + Intergenic
1200169339 X:154060982-154061004 GAAGCTGGACACCTGGACCAGGG + Intronic
1200512791 Y:4100393-4100415 GTTTCTGGGCACTTTGAGGAAGG + Intergenic
1201792589 Y:17858695-17858717 AAATCTGGGCACTTTGAAAAAGG + Intergenic
1201808965 Y:18047291-18047313 AAATCTGGGCACTTTGAAAAAGG - Intergenic
1202025050 Y:20512552-20512574 CAAGCTGGGCAATTAGAACAAGG + Intergenic
1202140081 Y:21712572-21712594 GAAGGTAGGTACTTTGAGTAAGG - Intergenic
1202354124 Y:24027942-24027964 AAATCTGGGCACTTTGAAAAAGG + Intergenic
1202516655 Y:25642170-25642192 AAATCTGGGCACTTTGAAAAAGG - Intergenic