ID: 996920908

View in Genome Browser
Species Human (GRCh38)
Location 5:128766537-128766559
Sequence TATAGACAGATGGTTCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996920908_996920914 3 Left 996920908 5:128766537-128766559 CCAAAATGAACCATCTGTCTATA 0: 1
1: 0
2: 3
3: 16
4: 214
Right 996920914 5:128766563-128766585 CTATCTGGATGGAGACCAGCAGG No data
996920908_996920916 10 Left 996920908 5:128766537-128766559 CCAAAATGAACCATCTGTCTATA 0: 1
1: 0
2: 3
3: 16
4: 214
Right 996920916 5:128766570-128766592 GATGGAGACCAGCAGGTTCTGGG 0: 1
1: 0
2: 1
3: 30
4: 234
996920908_996920915 9 Left 996920908 5:128766537-128766559 CCAAAATGAACCATCTGTCTATA 0: 1
1: 0
2: 3
3: 16
4: 214
Right 996920915 5:128766569-128766591 GGATGGAGACCAGCAGGTTCTGG No data
996920908_996920911 -8 Left 996920908 5:128766537-128766559 CCAAAATGAACCATCTGTCTATA 0: 1
1: 0
2: 3
3: 16
4: 214
Right 996920911 5:128766552-128766574 TGTCTATAACCCTATCTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996920908 Original CRISPR TATAGACAGATGGTTCATTT TGG (reversed) Intronic
907064382 1:51465776-51465798 TGTAGTCAGAAGGTTAATTTAGG - Intronic
910052241 1:82988571-82988593 TATAAACACGTGGTTCATTTTGG - Intergenic
910233864 1:85013942-85013964 TATAGCCAAGTGTTTCATTTTGG + Intronic
911524165 1:98964322-98964344 TATAGACAGCTGGTGCCTGTGGG - Intronic
913682722 1:121202214-121202236 TACAGACATTTGCTTCATTTGGG + Intronic
914034564 1:143989840-143989862 TACAGACATTTGCTTCATTTGGG + Intergenic
914154888 1:145078128-145078150 TACAGACATTTGCTTCATTTGGG - Intronic
914264895 1:146030241-146030263 TAAAGAAAAATGGTTTATTTGGG + Intergenic
916516486 1:165522696-165522718 AATTGACAGAGGATTCATTTTGG + Intergenic
916799580 1:168203891-168203913 TATAGACAAGAGGTTTATTTTGG + Intergenic
918932083 1:190867195-190867217 TATCGAAACATGGATCATTTTGG - Intergenic
919547628 1:198943318-198943340 TAAAGACAGAAGATTCATCTGGG - Intergenic
920470034 1:206220731-206220753 TACAGACATTTGCTTCATTTGGG + Intronic
923486807 1:234440712-234440734 TATAGAAATATGATTGATTTTGG - Intronic
923896124 1:238272052-238272074 TATAAAAATATGGTACATTTCGG + Intergenic
1065863005 10:29887101-29887123 CATAGGCAGATGGTACAATTGGG - Intergenic
1068132819 10:52916020-52916042 TATAGACAGATGACTTACTTTGG + Intergenic
1068584398 10:58780511-58780533 TATAGACACATGATGAATTTAGG - Intronic
1073551273 10:104403999-104404021 CAGAACCAGATGGTTCATTTGGG + Intronic
1073805367 10:107091766-107091788 TGTAGCCAAATGGATCATTTAGG - Intronic
1073925865 10:108514488-108514510 TGTTTACAGATGGTTCCTTTTGG + Intergenic
1074513236 10:114138557-114138579 TATAGACTGATGCTGCAATTTGG + Intronic
1077937004 11:6798804-6798826 TATAGAAATATGGGTAATTTTGG - Intergenic
1079026967 11:16956708-16956730 TATAGACAGATTGTGGATTAGGG - Intronic
1080000593 11:27344756-27344778 TATAAACACATAGATCATTTTGG - Intronic
1080870832 11:36235597-36235619 TATAGACAAATGGTTAACTATGG - Intergenic
1081129319 11:39358310-39358332 TATAGATTGGTGATTCATTTTGG + Intergenic
1081551537 11:44117453-44117475 TTTAGATTTATGGTTCATTTTGG + Intronic
1084133230 11:67153833-67153855 TATACACAGTTGGTTGTTTTTGG - Intronic
1085438488 11:76533872-76533894 GATAGACAGTAGCTTCATTTAGG + Intronic
1085916434 11:80893985-80894007 TATAGACAGACTGCTAATTTTGG + Intergenic
1086753916 11:90534222-90534244 TGCAGCCAGATGGTTTATTTTGG + Intergenic
1086935500 11:92741706-92741728 AACAGAAAGATGGTTCATCTTGG - Intronic
1087105565 11:94403548-94403570 TCTAGTGAGAGGGTTCATTTGGG + Intergenic
1087601635 11:100324092-100324114 TATAGATAAAGTGTTCATTTGGG + Intronic
1087985937 11:104679605-104679627 TATAGACATATGGATAATTTGGG + Intergenic
1088454911 11:110023484-110023506 TAAAGACAGATGGCACATTATGG + Intergenic
1089385163 11:118062529-118062551 TGGAGACAGGTGGTTCACTTGGG + Intergenic
1089427446 11:118391106-118391128 TATAAACAGATGGTTCTTTTTGG + Intronic
1089726905 11:120489457-120489479 TAGAGGCATATGCTTCATTTAGG - Exonic
1092078480 12:5693073-5693095 AACAGACATAGGGTTCATTTAGG + Intronic
1092539253 12:9409885-9409907 TATAGATAGATAGTTAGTTTAGG + Intergenic
1092565939 12:9665479-9665501 TAAAGACAGAGGGATTATTTTGG - Intronic
1092668135 12:10830078-10830100 TATTAAGAGATGGTTCCTTTAGG + Intronic
1093640118 12:21517888-21517910 TACAGACAGAAGGCTGATTTTGG - Exonic
1093842146 12:23917213-23917235 TATTGAGAGAAGGTACATTTAGG + Intronic
1093844913 12:23957996-23958018 TATAGACCCATGATTTATTTAGG - Intergenic
1094546375 12:31408172-31408194 TATATACAGATGTGTGATTTGGG + Intronic
1095851280 12:46809792-46809814 TTTGGACAGATGGTATATTTAGG + Intronic
1095941503 12:47730169-47730191 TGTAGGCAGATGGTTCCTTTGGG - Intergenic
1096009004 12:48197442-48197464 TATAGAAATATGGTTTATCTAGG - Intergenic
1096273038 12:50181871-50181893 TATAGACAGATGGCTTGTTTTGG + Intronic
1096579310 12:52574221-52574243 AATAGAGAGATGGTTTCTTTTGG - Intergenic
1097587814 12:61535835-61535857 TAGAGACAGATGGATCACTAGGG + Intergenic
1100556500 12:95699670-95699692 CAAAGATAGCTGGTTCATTTGGG + Intronic
1102451995 12:113048963-113048985 TATGCAGAGCTGGTTCATTTGGG - Intergenic
1102622970 12:114211426-114211448 TCTGGACAGATAGTTTATTTAGG + Intergenic
1103235322 12:119367828-119367850 TAGAGACAGAAGGTAAATTTGGG + Intronic
1106863097 13:33932919-33932941 TATGGACATATTGTCCATTTAGG - Intronic
1107691083 13:42953894-42953916 TATAGGCAGATTGTTCATAGAGG - Intronic
1108514145 13:51182020-51182042 TATGGGCAGATGGTTTATTTGGG - Intergenic
1108948657 13:56058632-56058654 AATAGAAAGATTCTTCATTTGGG + Intergenic
1114676583 14:24444434-24444456 TGTAGACTGATGATTTATTTGGG - Intergenic
1115890429 14:38021122-38021144 TAGAGAAAGATGTTTGATTTGGG + Intronic
1116067735 14:40005547-40005569 AATAGTCAGTTGGGTCATTTGGG + Intergenic
1116362003 14:44011803-44011825 CATATATAGATTGTTCATTTAGG + Intergenic
1119692426 14:76686266-76686288 AATAGAAAGATTCTTCATTTGGG + Intergenic
1120726016 14:87942295-87942317 TATAGACAGATACTTCATAGGGG - Intronic
1120941920 14:89957106-89957128 TTTAGACAGCAGGTTCCTTTTGG + Intronic
1121971112 14:98357180-98357202 GACAGAGAGATGGTTCATTATGG + Intergenic
1122260708 14:100520016-100520038 TATATACACATTGATCATTTGGG + Intronic
1125103594 15:35944649-35944671 TATAGAAACATGGTTGATATGGG - Intergenic
1126222445 15:46230031-46230053 TATAGAGAGGTGGTTGATTTGGG + Intergenic
1127180674 15:56413769-56413791 TATACACAGATAATACATTTTGG + Intronic
1128690793 15:69723476-69723498 TATAGAAAGAGGGTTGAATTGGG + Intergenic
1135962402 16:27007751-27007773 TATAGACATATAGTTGACTTTGG - Intergenic
1140679902 16:77375003-77375025 AATAAACAGATGGTTTCTTTTGG - Intronic
1142473862 17:178843-178865 TCAAGCCAGATGGTTCATTACGG - Intronic
1146815985 17:35942994-35943016 TAGAGCCCGATGGTTCAGTTGGG - Intronic
1150569458 17:66373645-66373667 TGTAGAAAGTTGGTTAATTTTGG + Intronic
1151346425 17:73505275-73505297 TAAAGTCAGATGGTTGAGTTGGG - Intronic
1151952720 17:77364065-77364087 GAGGGACAAATGGTTCATTTAGG + Intronic
1152789292 17:82270120-82270142 TGAAGACAGATTGTTCTTTTTGG + Intronic
1157084089 18:44559893-44559915 TAAAGACACTTGGTTCATTTTGG + Intergenic
1157882027 18:51329696-51329718 TCTACACAGAATGTTCATTTTGG - Intergenic
1158326992 18:56323205-56323227 TATGGAGAGATGCTTCAATTGGG - Intergenic
1158423835 18:57321713-57321735 TTTAGACACATGGTTCAACTTGG + Intergenic
1168157355 19:54482539-54482561 TACAGACACATGATTGATTTTGG - Intergenic
927297928 2:21476532-21476554 TAAAGACAGTTTGGTCATTTAGG - Intergenic
927412290 2:22840651-22840673 AAAAGGGAGATGGTTCATTTGGG + Intergenic
929345879 2:40884303-40884325 TATAGACAGATCATACCTTTTGG - Intergenic
929477573 2:42267520-42267542 TATTTACATATGGTACATTTAGG + Intronic
929626523 2:43414500-43414522 AATAGACAAATGCTTCATTTTGG - Intronic
929831486 2:45350431-45350453 TCCAGACAGATGGAACATTTGGG - Intergenic
930861125 2:56073953-56073975 TATATACACATGTTTCATATGGG + Intergenic
931215554 2:60239688-60239710 TGTAGACTGATGATTTATTTGGG - Intergenic
931843288 2:66177000-66177022 TGAAGACAGATGGCACATTTAGG + Intergenic
932804280 2:74769441-74769463 TATGCACTGATGTTTCATTTAGG - Intergenic
933059215 2:77715387-77715409 GAAAGACAGATGGCTCATTTTGG - Intergenic
933596110 2:84284889-84284911 TAAAGAAAGAAGGTTTATTTTGG - Intergenic
935956252 2:108379568-108379590 TACAAAGATATGGTTCATTTAGG + Intronic
936662441 2:114557325-114557347 CAGAGACAGATGGATCATCTGGG - Intronic
938106553 2:128535104-128535126 TATGGGTAGAGGGTTCATTTGGG - Intergenic
939210142 2:139164177-139164199 TATATACAGATCTTTCATTTTGG + Intergenic
939214802 2:139222200-139222222 TATAGACATATGGTTCATTCGGG - Intergenic
940758877 2:157715560-157715582 TATAGAAATATGGTGCATGTGGG + Intergenic
940867055 2:158827597-158827619 CCTAGACAGATGGATCACTTGGG - Intronic
942412615 2:175726988-175727010 TATAGACAGACTGTTCAAATAGG + Intergenic
942590572 2:177541762-177541784 TACTGACAGATGGCTCATTTGGG - Exonic
943003991 2:182366468-182366490 TATAGAGAGGTGGTTAGTTTAGG - Intronic
943777727 2:191785209-191785231 TATAGACATGTGGTTCATTTTGG + Intergenic
948101581 2:235378478-235378500 TAGAGTCAGGTGATTCATTTTGG - Intergenic
1170919662 20:20665689-20665711 TATAAACATGTGGTCCATTTTGG - Intronic
1172870146 20:38130572-38130594 TAAAAGCAGATGGTGCATTTAGG + Intronic
1173828670 20:46063891-46063913 TATATACAGCTGGTTCTTTGGGG + Intronic
1175359593 20:58398395-58398417 TATAGACAGATGACTCCTTCTGG + Intronic
1177316737 21:19471889-19471911 TATTGCCAGATGGTGGATTTTGG + Intergenic
1178527464 21:33343712-33343734 TATAAACAGATTGTCAATTTTGG + Intronic
1180031687 21:45213578-45213600 TATAGACAGATGGTACATACTGG - Intronic
949436705 3:4037718-4037740 CATAGACACTTGGGTCATTTGGG + Intronic
949700027 3:6745905-6745927 TTTACAAAGATGGTTGATTTTGG + Intergenic
951390828 3:22101544-22101566 TATAGAGAAATGGTTCAGTGTGG - Intronic
956140939 3:66146661-66146683 TATAAACAGATGGCACATTCAGG + Intronic
956584092 3:70845645-70845667 TCTAAACATGTGGTTCATTTAGG - Intergenic
958518827 3:95157693-95157715 TTTAGACAGATGATACAGTTTGG - Intergenic
962084005 3:132171717-132171739 TATAAAGAGATTCTTCATTTTGG - Intronic
962835924 3:139188415-139188437 TAAAGACAGAAGGATCATTTGGG - Intronic
964056976 3:152472820-152472842 TATGGACAGATGGATTATTCTGG + Intergenic
964820093 3:160758938-160758960 TGTAGCCAGTTAGTTCATTTTGG + Intronic
965365488 3:167793807-167793829 TATATATATATAGTTCATTTTGG + Intronic
965503424 3:169482986-169483008 TATTGACAGAGGTTTCACTTTGG + Intronic
966278456 3:178203431-178203453 AACAGAGAGATGTTTCATTTTGG + Intergenic
970146505 4:13041883-13041905 TAAAGACAAAAGGTTTATTTAGG + Intergenic
971045974 4:22805751-22805773 TATATAGAAATAGTTCATTTTGG - Intergenic
971539451 4:27797400-27797422 TATAGACAGAAGATACATTTAGG + Intergenic
972120848 4:35700269-35700291 GAGAGAGAGATGGTTAATTTCGG - Intergenic
974272358 4:59666957-59666979 GATATACAGATTATTCATTTCGG + Intergenic
974916157 4:68181433-68181455 AATAGACAGAAGGATCAATTGGG + Intergenic
975024973 4:69536187-69536209 TATAGACATATGAGTTATTTTGG - Intergenic
977025725 4:91816887-91816909 TATCAACACATTGTTCATTTGGG + Intergenic
977286643 4:95116117-95116139 TATAGACAAATGGTAGTTTTTGG - Intronic
977493520 4:97743499-97743521 TATTGACAGGTGATTCAATTTGG - Intronic
977653849 4:99499235-99499257 TATAGATAGATGGGGCAATTTGG - Intergenic
977987741 4:103404323-103404345 TATAGTCAGATGCTTTATTATGG - Intergenic
978678216 4:111344581-111344603 TATAGACATTAGGTTCATTGTGG + Intergenic
979021774 4:115509485-115509507 TATAGTCACATTGTTCATTAGGG - Intergenic
979214325 4:118144518-118144540 TATATGCAAATGGTTCATTGTGG - Intronic
979402025 4:120260582-120260604 TAAAAAAAAATGGTTCATTTTGG - Intergenic
979553385 4:122016866-122016888 TTTAGAGAAATGGTTAATTTTGG - Intergenic
979736504 4:124092330-124092352 TATAAACAGACAGTACATTTTGG + Intergenic
980495324 4:133583060-133583082 TATAGAAATATGATTGATTTGGG - Intergenic
981180320 4:141734516-141734538 TAGTGATAAATGGTTCATTTTGG + Intergenic
982999216 4:162390801-162390823 TAGAATCAGAAGGTTCATTTTGG - Intergenic
983463725 4:168059698-168059720 TATAGACTTCTGGATCATTTTGG + Intergenic
984180083 4:176471765-176471787 TATAAACAGATGCTCCAATTTGG - Intergenic
986736458 5:10671603-10671625 GAGGGACACATGGTTCATTTTGG + Intergenic
988075276 5:26344298-26344320 TAAAGAGAAATGTTTCATTTTGG - Intergenic
988730763 5:33970463-33970485 TGTATACAGATAGTTTATTTGGG - Intronic
988778709 5:34499890-34499912 TAAAAACAGATGCTTCATTTAGG - Intergenic
989603788 5:43224593-43224615 TATAAGTAGAGGGTTCATTTGGG + Intronic
990263337 5:54048751-54048773 AATAGGCAAATGGTTCCTTTGGG - Intronic
991614809 5:68484844-68484866 TCTAGACAGATGGCTCTTTCAGG - Intergenic
991771080 5:70041833-70041855 GATGGACAGATGTATCATTTTGG + Exonic
991850372 5:70917250-70917272 GATGGACAGATGTATCATTTTGG + Exonic
994928733 5:106153936-106153958 TATAAACAAATGCTTTATTTTGG - Intergenic
995114589 5:108465532-108465554 TCTAGACAGGTAGATCATTTGGG - Intergenic
996652801 5:125901445-125901467 CAAAGACAGATGGTTCAGCTGGG + Intergenic
996920908 5:128766537-128766559 TATAGACAGATGGTTCATTTTGG - Intronic
998807267 5:145930942-145930964 GATAGACAGATAGATCACTTAGG - Intergenic
998966900 5:147551011-147551033 TATTTACAGATAGTTTATTTGGG + Intergenic
1002999902 6:2321401-2321423 TGTATATAGATGGTTAATTTTGG + Intergenic
1003354192 6:5350676-5350698 TATATATACATGATTCATTTTGG - Intronic
1004466289 6:15888394-15888416 TATTGACAGACGGTTTCTTTGGG - Intergenic
1005219190 6:23566549-23566571 AATGGACAGATGGTTCATGGGGG + Intergenic
1005251744 6:23954414-23954436 TATAGCCAGATGCTTGACTTTGG - Intergenic
1005418177 6:25623189-25623211 AATGGACAGGTGGTTCAATTAGG + Intergenic
1006484605 6:34328507-34328529 TATACACAGATGCTTGAATTAGG - Intronic
1006571866 6:35012286-35012308 AATAGACTGAGAGTTCATTTTGG - Intronic
1007144558 6:39615450-39615472 TATCCACAGATAGTTCCTTTTGG - Intronic
1007388283 6:41534197-41534219 TAGAGATAGATGTTTCATATTGG - Intergenic
1007518441 6:42431816-42431838 CATTGACAGAAGGTGCATTTGGG - Intronic
1009491049 6:64291287-64291309 AATAAAAAGATTGTTCATTTTGG - Intronic
1011512311 6:88114643-88114665 TATTTAGAGATGGTGCATTTGGG - Intergenic
1012494245 6:99816779-99816801 TATATTCATATGGTACATTTGGG + Intergenic
1014329324 6:120041224-120041246 TATAGAAAGAAGTTTAATTTAGG + Intergenic
1014348769 6:120311936-120311958 TTTAGACAGAAGGATGATTTTGG - Intergenic
1014952791 6:127577977-127577999 TATAGACAGAAGTTACATTTTGG + Intronic
1015741033 6:136454265-136454287 GATAGATAGATAGATCATTTAGG - Intronic
1016315601 6:142782591-142782613 TATAGACAACTTGCTCATTTTGG - Intronic
1017560690 6:155625109-155625131 TATAGACAGATGGTTGTGATTGG + Intergenic
1020548785 7:9571284-9571306 TATAGACAGAAGGTATATGTAGG - Intergenic
1021754463 7:23837907-23837929 AATAGACAGTTGACTCATTTTGG + Intergenic
1021944298 7:25710713-25710735 TATAGATATTTGTTTCATTTGGG + Intergenic
1021972057 7:25975008-25975030 TATAAATAGAGGGATCATTTTGG - Intergenic
1023631158 7:42165592-42165614 AATAGACTGCTGGTGCATTTGGG + Intronic
1025154448 7:56591287-56591309 TTTAGAAACATGTTTCATTTTGG + Intergenic
1028559759 7:92161140-92161162 TATAGAAGGAAGGTTCCTTTTGG + Intronic
1028766107 7:94561562-94561584 CACAGACAGATGGGCCATTTAGG - Intergenic
1029868267 7:103659695-103659717 TATAGTCAGATGGTACTTGTGGG + Intronic
1030414388 7:109222884-109222906 TAAAGACAGGAGCTTCATTTGGG - Intergenic
1031043188 7:116860431-116860453 GAAAAACTGATGGTTCATTTGGG - Intronic
1031244478 7:119291064-119291086 GATAGACAAATAGTTCGTTTTGG - Intergenic
1033937222 7:146602028-146602050 TAAAGACAAATGTTTTATTTTGG + Intronic
1038852967 8:31298110-31298132 AAAATACACATGGTTCATTTAGG + Intergenic
1040812238 8:51467069-51467091 TACAGACACATGGGTCTTTTTGG - Intronic
1041784744 8:61619497-61619519 TATACACAGATGATCCATTGGGG + Intronic
1041994277 8:64034860-64034882 TATATACAGATGTTACATCTAGG + Intergenic
1042231730 8:66562181-66562203 TGTACACAGATGCTTTATTTTGG + Exonic
1042529466 8:69800058-69800080 TATCAACAGATAGTTCAATTTGG - Intronic
1042736826 8:71999021-71999043 TAAAGACAAATTCTTCATTTTGG + Intronic
1043435927 8:80236410-80236432 TATTGACTGAGGGCTCATTTTGG - Intergenic
1052157341 9:25208758-25208780 TAAAGACAGGTAGTGCATTTAGG + Intergenic
1053569028 9:39284966-39284988 TTTTTACAGATGTTTCATTTTGG - Intronic
1053834991 9:42126013-42126035 TTTTTACAGATGTTTCATTTTGG - Intronic
1054090661 9:60843943-60843965 TTTTTACAGATGTTTCATTTTGG - Intergenic
1054112072 9:61119500-61119522 TTTTTACAGATGTTTCATTTTGG - Intergenic
1054128116 9:61334041-61334063 TTTTTACAGATGTTTCATTTTGG + Intergenic
1054595541 9:67061516-67061538 TTTTTACAGATGTTTCATTTTGG + Intergenic
1054703016 9:68432905-68432927 TAAAAAAATATGGTTCATTTAGG - Intronic
1055979428 9:81987485-81987507 TATAAACACACAGTTCATTTGGG - Intergenic
1058708401 9:107656805-107656827 TATAGAGAGAAGGGTAATTTTGG + Intergenic
1058762516 9:108148854-108148876 ATTAGACTGATGGTTCATTATGG + Intergenic
1062695661 9:137874951-137874973 TGTAGACAGCTTGTTCAGTTAGG - Intergenic
1062695671 9:137875029-137875051 TGTAGACAGCTTGTTCAGTTAGG - Intergenic
1185955997 X:4489766-4489788 TATATCCAGATGTTTGATTTGGG - Intergenic
1187066570 X:15845183-15845205 TATGGATGGATGGTTCAGTTTGG - Intronic
1197912233 X:131495601-131495623 TATAGATATATGTTTTATTTTGG - Intergenic
1197979535 X:132200598-132200620 TATAGAGAGATGGTCCATACAGG - Intergenic
1199260542 X:145768581-145768603 CACAGACAGGTAGTTCATTTGGG + Intergenic
1199315152 X:146368174-146368196 TATTGACAGCTCTTTCATTTGGG + Intergenic
1199608928 X:149597665-149597687 TATAGACAGATGTTCCTTCTGGG + Exonic
1199630191 X:149771692-149771714 TATAGACAGATGTTCCTTCTGGG - Intergenic
1199658680 X:150024259-150024281 TATAAAGAGGTGGGTCATTTTGG - Intergenic
1199750781 X:150815660-150815682 TTTAGGCAGATGGAACATTTTGG - Intronic