ID: 996920914

View in Genome Browser
Species Human (GRCh38)
Location 5:128766563-128766585
Sequence CTATCTGGATGGAGACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996920909_996920914 -7 Left 996920909 5:128766547-128766569 CCATCTGTCTATAACCCTATCTG 0: 1
1: 0
2: 1
3: 11
4: 186
Right 996920914 5:128766563-128766585 CTATCTGGATGGAGACCAGCAGG No data
996920908_996920914 3 Left 996920908 5:128766537-128766559 CCAAAATGAACCATCTGTCTATA 0: 1
1: 0
2: 3
3: 16
4: 214
Right 996920914 5:128766563-128766585 CTATCTGGATGGAGACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996920914 Original CRISPR CTATCTGGATGGAGACCAGC AGG Intronic
No off target data available for this crispr