ID: 996924123

View in Genome Browser
Species Human (GRCh38)
Location 5:128802789-128802811
Sequence AGTATCTATTAGGAAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996924123 Original CRISPR AGTATCTATTAGGAAAAAGA AGG Intronic
901194131 1:7430830-7430852 AGACTCTAATAGGAAACAGATGG - Intronic
902584730 1:17431745-17431767 ATTATGTAACAGGAAAAAGATGG + Intronic
903317091 1:22516545-22516567 AGACTCTGTTAGGAAAAAAAGGG - Intronic
904152068 1:28449919-28449941 AATATTTACTAGGAAAAATATGG + Intronic
904227788 1:29038726-29038748 AGTACCATATAGGAAAAAGATGG + Intronic
904635690 1:31879224-31879246 ATTATTTAGTAGGAAAAAGCAGG + Intergenic
906349711 1:45047881-45047903 AGAAAATTTTAGGAAAAAGATGG + Intronic
906644634 1:47465506-47465528 AGTGACTATGAGCAAAAAGAAGG + Intergenic
906814244 1:48861881-48861903 ACTATCTCTTAGGAAAATGGGGG - Intronic
906971548 1:50519777-50519799 AGTATCTTCTAGAAGAAAGAAGG - Intronic
908163988 1:61439358-61439380 AAGATCTATGAGGAAAAAAAAGG - Intronic
910228626 1:84963461-84963483 AGTAGGTATCAGGAAAAAGAAGG + Intronic
912020386 1:105102377-105102399 GGAATCTACTAGAAAAAAGAAGG + Intergenic
912183292 1:107244488-107244510 AGTGTCTATTAGGGAATAAAAGG - Intronic
915045404 1:153009514-153009536 TGTATCTAATAGTAAAAAGCTGG + Intergenic
915062732 1:153199651-153199673 AGTACCAAGTAGGAAAGAGAAGG + Intergenic
915236321 1:154485727-154485749 ATTATCTATTATGATAATGAAGG - Intronic
918107151 1:181425076-181425098 AATATCTCTTCTGAAAAAGAGGG - Intronic
918319711 1:183352991-183353013 AGAATGTATTCAGAAAAAGATGG - Intronic
920496014 1:206455381-206455403 AGTATGGATTGGAAAAAAGAAGG - Intronic
921068613 1:211640538-211640560 AGTAACTTTTAGTAGAAAGAAGG - Intergenic
921950699 1:220927031-220927053 AGTATTTATTAGAAATAAGATGG + Intergenic
922432056 1:225564856-225564878 TGTATGTAGTAGGAAAAAAAGGG - Intronic
923613263 1:235514246-235514268 ATTCTGTATTAGGAAGAAGATGG - Intergenic
923969822 1:239187755-239187777 TGCATCTATTAGGAAAATGTAGG - Intergenic
924474797 1:244373583-244373605 AATATCTATTATTAAAAAGGGGG - Intronic
924557678 1:245131576-245131598 AGTATCACTGAGGAAATAGAGGG + Intergenic
1063955590 10:11262507-11262529 AGTCTGTATTTGGAACAAGATGG - Intronic
1064487438 10:15809164-15809186 AGAATCAATGAGGAAAACGATGG + Intronic
1064637255 10:17381329-17381351 AGTCTATAATAGGAAAAAGGGGG + Intronic
1064767069 10:18685887-18685909 AGTCTCTATGAGCAAAAATACGG - Intergenic
1064777684 10:18797172-18797194 AATATCAAAAAGGAAAAAGAAGG + Intergenic
1065333144 10:24625012-24625034 TGTATCTAATAGGCAAAACAGGG - Intronic
1065565724 10:27006810-27006832 AGTATCTATTAGCCAAACAATGG + Intronic
1065765320 10:29024571-29024593 AGCAACTCTTAGGAAAAAAAAGG + Intergenic
1066154888 10:32664981-32665003 AGTAACTATTATCAAAAAGATGG - Intronic
1067959725 10:50834502-50834524 AGTTTTTATTGGGAAATAGAAGG + Intronic
1068193189 10:53681140-53681162 AGTCTCTAATAGGAAAAAGCTGG + Intergenic
1068227946 10:54130972-54130994 AGTCTCTATTAGAAAGAACAAGG - Intronic
1068362107 10:55989416-55989438 AGTATCTATTAAGGAAAATATGG - Intergenic
1068544607 10:58331709-58331731 AAGACCTATGAGGAAAAAGATGG - Intergenic
1068847649 10:61696986-61697008 ATTAGCTAATAGTAAAAAGATGG + Intronic
1068878863 10:62027613-62027635 AGTATCTCTTAAGAATAAAATGG + Intronic
1068904237 10:62305434-62305456 AGTTCCTGTTAGGAATAAGATGG + Intergenic
1069181795 10:65370201-65370223 AGTATTTATTAAGAAAAATTTGG - Intergenic
1069250477 10:66260173-66260195 ATTATCTATTACAGAAAAGAAGG + Intronic
1069498925 10:68931953-68931975 AGGAACTACTAGGTAAAAGAAGG - Intronic
1069769078 10:70886368-70886390 AGTACATAATAGGAAAAGGAAGG - Intronic
1070381930 10:75888894-75888916 AGTAGGTATTAGGATAAAAATGG + Intronic
1071284498 10:84131989-84132011 AGCATCTGGTAGGAAACAGATGG - Intergenic
1071682624 10:87721580-87721602 AGTATATAATAGCAAAAAGCTGG - Intronic
1071805966 10:89121300-89121322 AGTATTTATGAGGAAAAATCTGG + Intergenic
1072180806 10:92977868-92977890 AGTATGTCTTATGAAAAAGCAGG - Intronic
1072264917 10:93718101-93718123 ACTATCTCTTAGAAAAATGAGGG + Intergenic
1073147490 10:101290411-101290433 AGGATATAATTGGAAAAAGAAGG + Intergenic
1073203169 10:101752874-101752896 AGTATGTATTGGGTACAAGAAGG + Intergenic
1073752041 10:106539864-106539886 AGTAGATAGTATGAAAAAGAAGG - Intergenic
1075421354 10:122302973-122302995 ACCATCAATAAGGAAAAAGAAGG - Intronic
1076561446 10:131368321-131368343 AGAAACTATTAGGAAATGGAAGG - Intergenic
1079354821 11:19721862-19721884 ACTCTCAATTAGGAAAAATAAGG + Intronic
1079893568 11:26090098-26090120 GGTAACTATTAGGAAACAGCAGG + Intergenic
1080374370 11:31690410-31690432 ATTTTTTTTTAGGAAAAAGAAGG - Intronic
1081095868 11:38934428-38934450 TGTTTCTTTTAGAAAAAAGAAGG + Intergenic
1081362272 11:42195073-42195095 AGTATCTATTAATACACAGAAGG + Intergenic
1084380400 11:68808324-68808346 AGTATATATTATGGTAAAGATGG + Intronic
1084765954 11:71308572-71308594 ATTATCTAGAAGGAAAAAGTAGG + Intergenic
1085132817 11:74056372-74056394 AGATTTTATTAGGACAAAGAGGG - Intronic
1086160337 11:83715267-83715289 AATATCTAGTAGGAAATATATGG - Intronic
1086339836 11:85837545-85837567 AGGATGTATTCGGAAAAATAGGG - Intergenic
1087313761 11:96581552-96581574 GGAATCTATTCGGATAAAGAAGG - Intergenic
1087743489 11:101915463-101915485 GGAATCTAATTGGAAAAAGATGG - Intronic
1087851624 11:103037445-103037467 ACAATCTATTAGGAAGAAGCAGG + Intergenic
1087956750 11:104297901-104297923 AGAATCCATTTGGAAAAATAAGG - Intergenic
1089121039 11:116135313-116135335 AATCTCAATTAGGAAAAAGGAGG - Intergenic
1089199618 11:116715908-116715930 AGTTTCCACTAGTAAAAAGAAGG + Intergenic
1090550152 11:127810542-127810564 AGTATCTGTTAAGTAAAAAAGGG - Intergenic
1091139867 11:133225808-133225830 AGTCTTAATTAGGAAAAGGATGG + Intronic
1091346998 11:134861764-134861786 AGTACCTTTTAGAAAAAAGTGGG - Intergenic
1092404852 12:8213303-8213325 AATAGCTATTATCAAAAAGATGG - Intergenic
1092688217 12:11074670-11074692 AGTATCTCTTAGAAAAATGGGGG + Intronic
1093415827 12:18919378-18919400 TGTATCTAATAGGAAGAAGTGGG + Intergenic
1093534652 12:20209356-20209378 TGTACCTATGGGGAAAAAGAAGG + Intergenic
1093563211 12:20568352-20568374 AATATTAATTAGGAAAAATAGGG + Intronic
1093688056 12:22078404-22078426 ACTATCTCTTAGAAAAATGAGGG + Intronic
1093802051 12:23385883-23385905 AGAAACTATTAGCAAAAATATGG + Intergenic
1093985731 12:25530334-25530356 AGAAACTATAAAGAAAAAGATGG - Intronic
1094623622 12:32102998-32103020 ATTATCTATGAGGAACAAAAAGG - Intergenic
1094708405 12:32937060-32937082 AGGATCTATTAAACAAAAGATGG - Intergenic
1094769882 12:33643459-33643481 AGTAACTGATAGGACAAAGAAGG - Intergenic
1095129497 12:38522504-38522526 ATTATATAGTAGGAAGAAGAGGG - Intergenic
1095293986 12:40507823-40507845 GGTAGCTATTAAGAAAGAGATGG - Intronic
1095294285 12:40510779-40510801 GGTAGCTATTAAGAAACAGATGG - Intronic
1095322995 12:40852256-40852278 AGTAACTATAAGGAAACCGAGGG - Intronic
1096172444 12:49483204-49483226 AATCTCTTTTAGGGAAAAGAGGG - Intronic
1096687410 12:53297744-53297766 TGTAGCTTTTTGGAAAAAGAGGG + Intronic
1099077918 12:78134919-78134941 GCAATGTATTAGGAAAAAGAGGG - Intronic
1100389385 12:94134635-94134657 AGTTTCTACCAGGAAAAAGAGGG + Intergenic
1100641869 12:96489858-96489880 AGGCTTTATGAGGAAAAAGAAGG + Exonic
1101121895 12:101590338-101590360 AATATTTATTAGGAATAAAAAGG + Intronic
1101411371 12:104471295-104471317 AGTAACTATTTGCTAAAAGAAGG + Intronic
1102503092 12:113366275-113366297 AATTTCTATTAAGAAAATGAGGG - Intronic
1104492247 12:129204308-129204330 AGTAGCCATTATAAAAAAGAAGG + Intronic
1106486204 13:30174798-30174820 AGTATCTCTTAGAAAAATGGGGG + Intergenic
1106961235 13:35000668-35000690 TGTATCCTTTAGGAAATAGAGGG + Intronic
1107229566 13:38091813-38091835 AATATCTATGAGGCAAAAAAGGG + Intergenic
1107344822 13:39447866-39447888 AGAAACTATAAGGAAAAAGGAGG + Intronic
1107441525 13:40431861-40431883 AATATCTACCAGTAAAAAGATGG - Intergenic
1108219718 13:48220930-48220952 GGTATCTAATAGGAAACAAAAGG + Intergenic
1108483663 13:50902378-50902400 AGTATAGATTGGGACAAAGAAGG - Intergenic
1108772515 13:53721578-53721600 AGTATCCATTGGGAATTAGAAGG - Intergenic
1108787954 13:53928980-53929002 AGTATATTTTAGCAAAAATAAGG - Intergenic
1109067488 13:57717107-57717129 GGTACCTGTTAGGAAAAAGATGG + Intronic
1109510264 13:63362869-63362891 AGAATCTAATAGGAAAAGTAAGG - Intergenic
1109665370 13:65528129-65528151 ATTATCTAAAAGGAAAAAAAAGG + Intergenic
1110744908 13:79040585-79040607 AGTTTCCATATGGAAAAAGAAGG + Intergenic
1111431830 13:88155710-88155732 AGTATCAATTAGGCAAAAAACGG + Intergenic
1111521513 13:89411011-89411033 TGTCTCTAATAGGAGAAAGATGG + Intergenic
1112037007 13:95506294-95506316 AGTGTCTGTTTGGAAAGAGAAGG - Intronic
1113746565 13:112749283-112749305 AATTTCTATTAAGAAATAGAAGG - Intronic
1115066080 14:29261727-29261749 AGTATCAATTAAGAAACATAAGG + Intergenic
1115361175 14:32504704-32504726 AGTAACTATTGGGAAGAAAAAGG - Intronic
1115741831 14:36397159-36397181 GGTCTCTATCATGAAAAAGAGGG + Intergenic
1115813871 14:37141615-37141637 TAAATCTACTAGGAAAAAGATGG - Intronic
1116116399 14:40657005-40657027 AATATCTATTGCGAAAAGGACGG + Intergenic
1116139405 14:40971390-40971412 AGCATCTAGAAGCAAAAAGATGG - Intergenic
1116204359 14:41843671-41843693 ACAATTTATTAGTAAAAAGAAGG - Intronic
1116286223 14:42975325-42975347 AGTATCTAATCAGAATAAGAAGG - Intergenic
1116678059 14:47930944-47930966 TGGATCAATTAGGAGAAAGAAGG + Intergenic
1117889866 14:60408210-60408232 AAGATCTAATAGGACAAAGAAGG - Intronic
1118115667 14:62773884-62773906 AGTATCTTTTATGGAAAAAAAGG + Intronic
1118140440 14:63074652-63074674 TGTATTTAATAGTAAAAAGAAGG - Intronic
1118421464 14:65609926-65609948 AGTATCAATCTGGCAAAAGATGG - Intronic
1118498296 14:66330909-66330931 GGTAAGTATTAGGAAAAAGTGGG + Intergenic
1118536586 14:66773175-66773197 AGTGTATGTCAGGAAAAAGATGG + Intronic
1120668586 14:87337066-87337088 GGTATCTATTAAGGAAAACAGGG - Intergenic
1120677859 14:87442887-87442909 AGTATAGATAAGAAAAAAGAGGG + Intergenic
1120680283 14:87472453-87472475 GGTTTCTGTTAGGAAACAGATGG - Intergenic
1121106069 14:91280590-91280612 AGCTTCTCTTAGGAAAAAGAAGG - Intronic
1121652356 14:95568243-95568265 TGTAACAATTAGGAAAAAAATGG - Intergenic
1121745437 14:96286424-96286446 GCTATGTATTAGGAAAAAAATGG + Intronic
1125498777 15:40223750-40223772 AATATTTAATAGGACAAAGATGG + Intergenic
1125638505 15:41209583-41209605 AGTATCTGGTAAGAAAAAGAAGG + Exonic
1125731728 15:41896145-41896167 AATATCTAGTAGGAATAGGAAGG + Exonic
1126025084 15:44438595-44438617 AGAATATATTAGGAAAAATACGG + Intronic
1126545439 15:49868563-49868585 AGTATTAATTTGGAAAAAAATGG + Intronic
1126989952 15:54362925-54362947 AGGATGTGTTAGGGAAAAGAAGG + Intronic
1127159615 15:56167968-56167990 ACTTTCTATTTGGAAAAATAAGG + Intronic
1131481074 15:92782374-92782396 ACTATCTCTTAGAAAAATGAGGG - Intronic
1134197914 16:12173204-12173226 AGTAGCTATTAGATAAAAGTGGG + Intronic
1134352482 16:13450944-13450966 AAGATCTAAGAGGAAAAAGAGGG - Intergenic
1135459791 16:22631861-22631883 AAAATAGATTAGGAAAAAGATGG - Intergenic
1138117379 16:54371227-54371249 ACTATCTAGTAGGAAAAAGGTGG + Intergenic
1138319761 16:56102039-56102061 AACATCTATTTGGAACAAGATGG - Intergenic
1139787511 16:69405811-69405833 ATTATATATAAAGAAAAAGAGGG + Intronic
1140523564 16:75603167-75603189 GGGATCTGTTTGGAAAAAGAAGG + Exonic
1141210078 16:81970953-81970975 AGGATCAATAAGGAAACAGAGGG - Intergenic
1141314947 16:82953091-82953113 ATAGTCTATGAGGAAAAAGAAGG - Intronic
1149106949 17:52980561-52980583 AAAATCTATTAGGAAAGAGAAGG + Intergenic
1149149593 17:53544576-53544598 AGGAGCTGTTAGGAAATAGAGGG - Intergenic
1149185057 17:53988185-53988207 AGTATCATTTAGCAGAAAGAGGG - Intergenic
1149439431 17:56662479-56662501 TGTGTCTATTAGGAAAAGGGCGG - Intergenic
1150164577 17:62929142-62929164 AGTGTCTATTAGGCAACAAAGGG + Intergenic
1151213469 17:72561651-72561673 ATTATTTATTAGGACAAAAAGGG - Intergenic
1153066944 18:1056418-1056440 ACCATTTATTAGGGAAAAGAGGG + Intergenic
1156018078 18:32568877-32568899 AGAAACTATAAAGAAAAAGATGG - Intergenic
1156322975 18:36045312-36045334 AGTACATATTAGGAAAAGCAGGG - Intronic
1157769217 18:50330199-50330221 AATATTACTTAGGAAAAAGAAGG - Intergenic
1159165888 18:64699347-64699369 AAAATTTATTAGGAAGAAGAAGG + Intergenic
1159380351 18:67649005-67649027 ATTATATATTAGGTAAAAAATGG - Intergenic
1159402465 18:67955773-67955795 AGAAGCTATTAGAAAAAAAATGG + Intergenic
1159608180 18:70496700-70496722 AATATCTATTATGAATATGAAGG - Intergenic
1162702534 19:12528354-12528376 ACTATATTTTAGGAAAAAAATGG - Exonic
1165222394 19:34327385-34327407 AGTAACTGGTAGGTAAAAGAGGG - Intronic
1167691925 19:50990676-50990698 AGTATCTGTTAGAAAGAGGAAGG + Intergenic
925933658 2:8732605-8732627 AGTACAGATGAGGAAAAAGAAGG + Intronic
927363476 2:22265067-22265089 AATATTTCTTAGGATAAAGAAGG - Intergenic
930154702 2:48094221-48094243 GGCATCTTTTAGCAAAAAGATGG - Intergenic
930355816 2:50318124-50318146 ATAATCTAATAGGAAAAAAATGG + Intronic
931076456 2:58719208-58719230 AGCATCTATTAGGAACATAAAGG - Intergenic
931156364 2:59635282-59635304 AGTGTCTAATAGAAAAAAGTAGG - Intergenic
932075997 2:68663441-68663463 GGGAACTATTAGGAAATAGAGGG - Intergenic
932694359 2:73942289-73942311 GCTAACTATGAGGAAAAAGAAGG - Intronic
935323261 2:101909009-101909031 ACTCCCTATTAAGAAAAAGAAGG + Intergenic
935564853 2:104595379-104595401 AGTATTCATTTGGAAAAAGCTGG - Intergenic
936558863 2:113519237-113519259 AGTAATTATTAGGAGAAAGCAGG + Intergenic
936625769 2:114147631-114147653 AATTTCTATTATGAAAAAGACGG - Intergenic
937553692 2:123128207-123128229 AGCATCTTTTAGGAAAAAATTGG + Intergenic
939094916 2:137823508-137823530 AGCATATATGAAGAAAAAGACGG - Intergenic
939499255 2:142961739-142961761 AGTATTTATTTGAAAAAAAAGGG + Intronic
939609489 2:144292366-144292388 AGTAACTGTTAGAAAAATGATGG - Intronic
940442397 2:153733485-153733507 AGAGACAATTAGGAAAAAGAGGG - Intergenic
940845811 2:158640916-158640938 AGTATCTCTCAGGAAAAACTAGG + Intronic
941029716 2:160496732-160496754 AGTATCTCTTAGGAAGAAGAAGG + Intergenic
941189437 2:162360175-162360197 ATTATCTATTAAGAATAAAATGG - Intronic
941391298 2:164918431-164918453 AGTATTTATTTTGAAAAACATGG + Intronic
942839313 2:180340449-180340471 AGTATCTACTAGGAAGAGAAGGG + Intergenic
943385074 2:187192971-187192993 AGTTTCAAATAGGTAAAAGAAGG + Intergenic
943415310 2:187594417-187594439 AGAATCTATAAAGTAAAAGATGG + Intergenic
944339055 2:198573930-198573952 AGTATATATTAGGAAAAAACAGG + Intergenic
945912628 2:215667018-215667040 TGTATCTTTGAAGAAAAAGAAGG + Intergenic
946989079 2:225307791-225307813 TGTATCTAGTTGCAAAAAGAAGG + Intergenic
947496075 2:230638094-230638116 AGTATCCATTAGGAGACAGGAGG + Intergenic
1168985054 20:2040814-2040836 ATTATCTCTTAGAAAAATGAGGG - Intergenic
1168997109 20:2141567-2141589 AGTTTTTAATAGGAAAAATAGGG - Intronic
1169705797 20:8503312-8503334 AGTATCTCTTAGGAATCAAAGGG - Intronic
1169881040 20:10346978-10347000 AGTATTTAGGAGGAAAAAAATGG - Intergenic
1170174779 20:13456851-13456873 AGTACCTACTAGGAAAAAAATGG + Intronic
1172419793 20:34806082-34806104 AGTGGCTATTACCAAAAAGATGG - Intronic
1173026711 20:39314145-39314167 AATCTCAATTATGAAAAAGATGG + Intergenic
1177470687 21:21557608-21557630 ATTATCAAATAGGACAAAGAAGG - Intergenic
1178530792 21:33373807-33373829 ACTATCTCTTTGGAAAATGAAGG + Intergenic
1178576896 21:33801391-33801413 AGCAGCTATTAGGAAAAAAGGGG - Intronic
1179009246 21:37542111-37542133 AATAAATATTGGGAAAAAGAGGG - Intergenic
1179334911 21:40441646-40441668 AGTATCTTTTAGACAAGAGAAGG - Intronic
1182211099 22:28678555-28678577 AGTATGTTTTAGGCAAAAGCAGG - Intronic
949354929 3:3170306-3170328 AGTGTCATTTAGGTAAAAGATGG + Intronic
949809720 3:7993187-7993209 GGTATGTGTTAGGAAAAGGATGG - Intergenic
949861008 3:8504722-8504744 TTTTTCTATTAGGAAAGAGAAGG + Intronic
951634862 3:24762472-24762494 AATATCTAATAGGGAAAAGAAGG + Intergenic
952242725 3:31550108-31550130 AGTATCCATTTGAAAAAGGAGGG - Intronic
952723990 3:36562628-36562650 AGTATGTATGTGGAAAAATAGGG - Intergenic
952753563 3:36845911-36845933 AGTATCTATCAAAATAAAGATGG - Intronic
953061408 3:39431085-39431107 AGTATCTACCAGGAAAGAGTAGG + Intergenic
953086269 3:39670965-39670987 AGAATCAATTAGAAAAAATAAGG - Intergenic
953150588 3:40320647-40320669 AGTATCCATGGGGAAAAGGATGG + Intergenic
953779565 3:45854863-45854885 AGTAGCTCTTAGCATAAAGAAGG - Intronic
956113226 3:65892022-65892044 AGTATCTATTTAGAACAATATGG - Intronic
957123552 3:76128327-76128349 AGTTTCTCTTACGAAAAAGAGGG + Intronic
957752784 3:84444073-84444095 ATTATATATTATGGAAAAGAAGG - Intergenic
958774949 3:98471043-98471065 AGGAAGTATTAGGAAAACGAAGG + Intergenic
959345415 3:105188448-105188470 AGTAAATAATATGAAAAAGAAGG - Intergenic
959535333 3:107478545-107478567 AGTATTTATTAAGTAATAGATGG + Intergenic
959627370 3:108467693-108467715 AGTATTTATTAGGAAATAATAGG + Intronic
960010612 3:112830759-112830781 AATACTTATTAAGAAAAAGAAGG - Intronic
960181084 3:114579712-114579734 AATAAATATTAGGAATAAGAGGG + Intronic
962117498 3:132526990-132527012 AGTTTCTGTTAGGAAGAATAAGG + Intronic
962871367 3:139496046-139496068 AGTATATATGAGGGAAAGGAAGG - Intergenic
964433475 3:156628978-156629000 AGGTTCTATTAGCAAACAGAAGG - Intergenic
965223939 3:165962814-165962836 AGTAGCTATTAGTAAACAAATGG - Intergenic
965334468 3:167419213-167419235 AATAACTATTATGAAATAGAGGG + Intergenic
965627775 3:170698948-170698970 AGTATCTTGATGGAAAAAGAGGG + Intronic
966601432 3:181779108-181779130 AATATATATTTTGAAAAAGAAGG + Intergenic
966937453 3:184720873-184720895 ATTATCTATTAAGAAAAAGCAGG - Intergenic
967111748 3:186299699-186299721 ATTGTATATTAGGAAAAAGGAGG - Intronic
969761276 4:9184690-9184712 AATAGCTATTATCAAAAAGATGG + Intergenic
970944098 4:21669876-21669898 AGAATCTATTTGGGAGAAGATGG + Intronic
972978494 4:44666606-44666628 ATCATCTATTATGACAAAGAAGG + Intronic
973693181 4:53461889-53461911 AATATGTATTAGCAAAAAGTTGG + Intronic
974062113 4:57044611-57044633 ATGATTCATTAGGAAAAAGATGG - Intronic
974062425 4:57047374-57047396 AGTAACTTATAAGAAAAAGATGG - Intronic
974123799 4:57670992-57671014 AGTATCTATAAGCAAAAGAAAGG - Intergenic
974507728 4:62798366-62798388 AGAGTCTGTTAGGAAATAGAGGG + Intergenic
976147649 4:82057961-82057983 AGGATGTTTTAGGATAAAGATGG - Intergenic
976256855 4:83108831-83108853 AGAATAAATTAGGAACAAGAAGG - Intronic
976814416 4:89130702-89130724 AGTACATTTCAGGAAAAAGAAGG + Intergenic
977838798 4:101676335-101676357 AGTTTCTTTTCAGAAAAAGATGG + Intronic
978277311 4:106967696-106967718 AATATTTGTTAGGAAAAAGAAGG + Intronic
978541899 4:109825953-109825975 AGAAACTATAAGGAAAAAAAAGG - Intergenic
978721417 4:111914605-111914627 AGTAAAAATTAGGAAAAAGTAGG - Intergenic
979224475 4:118268420-118268442 AGTATTTCTTAGAAAACAGAAGG - Intergenic
979438776 4:120726269-120726291 AGAATATATTAGGTAAAACAAGG + Intronic
979461946 4:120993929-120993951 AGTATTAATTGGGAAAGAGAGGG + Intergenic
979497438 4:121399066-121399088 AGTATTTATAATGAAAAATATGG + Intergenic
979898030 4:126185752-126185774 AGAATCTTTTAGGAAAAAGAGGG - Intergenic
980445498 4:132901356-132901378 AACATCTATTTGGAAAAAAATGG - Intergenic
980616883 4:135239766-135239788 ATTATCTATTAAGAAGATGATGG - Intergenic
981183737 4:141776641-141776663 AATATCTATGAAGAAAAATAAGG - Intergenic
981881753 4:149621846-149621868 AATATCTCTGAGGAAAAAAATGG - Intergenic
983289239 4:165780559-165780581 AGATTCTATTAGGAAAAGAAAGG + Intergenic
983455794 4:167962839-167962861 AGTTTGTTTTAGGAAAAAGGTGG - Intergenic
984450190 4:179889992-179890014 AGTATATATTAGAGAAGAGAGGG - Intergenic
984557087 4:181227506-181227528 AGTATCTAAGAGAAAAAAAACGG - Intergenic
986127217 5:4894275-4894297 AGTAAATATTAGGAAAGAGATGG - Intergenic
987664670 5:20921975-20921997 AGTATTTATAGTGAAAAAGAAGG + Intergenic
988127571 5:27061302-27061324 TGAAACTATTAGGAAAATGATGG - Intronic
988758017 5:34280208-34280230 AGTATTTATAGTGAAAAAGAAGG - Intergenic
989029767 5:37106737-37106759 GGTAGATATTTGGAAAAAGAGGG + Exonic
989116837 5:37963352-37963374 TATATTTATTAGGAAAAACAAGG + Intergenic
989161402 5:38394807-38394829 AGTATATTTCAAGAAAAAGAAGG - Intronic
989368789 5:40683188-40683210 AGTATCAATAAGGAAAAGGAAGG - Intronic
991270835 5:64778787-64778809 AGTATCTATTTGTAACCAGAGGG + Intronic
992690840 5:79238535-79238557 AGTATCCATTAGGGAAAACTGGG - Intronic
993182836 5:84576793-84576815 AGTCTCTATTAGGAAAGCTAAGG - Intergenic
993646539 5:90470472-90470494 GGTATCAATTAAAAAAAAGAAGG + Intronic
994089930 5:95800890-95800912 ATTTTCTGTTAGGAAAGAGATGG - Intronic
994263939 5:97692283-97692305 AGTATATATTAGGGAAAAGCGGG + Intergenic
996813755 5:127550416-127550438 AGTATATATTAGTAAAAATCTGG + Intronic
996924123 5:128802789-128802811 AGTATCTATTAGGAAAAAGAAGG + Intronic
998081461 5:139278471-139278493 GGTATCTATCAGGAAACAAATGG + Intronic
1000782818 5:165504866-165504888 AGTTTCTGAAAGGAAAAAGAAGG + Intergenic
1001278706 5:170370157-170370179 AGTTGCTAGTAAGAAAAAGACGG + Intronic
1002592519 5:180300536-180300558 GGTTTCTAGTAGGAAAAGGAGGG - Intergenic
1004469643 6:15917638-15917660 AGTCTCTGTTAGGAGAAAAAAGG - Intergenic
1005141196 6:22633567-22633589 AGTATCTATAGGGAAACAGGTGG - Intergenic
1006256436 6:32836194-32836216 AGTATCTATGATGACAGAGAAGG - Intronic
1008158215 6:48044011-48044033 AGGATCAATTGGGAAAAACAAGG - Intronic
1009191752 6:60637724-60637746 ACTATCTATTAAAAAAAAAATGG + Intergenic
1009223124 6:61001595-61001617 AATATCTATGGGGAAAAAGAAGG + Intergenic
1010013996 6:71083236-71083258 AGCATCAAATAGGAAAAAGTTGG - Intergenic
1010497820 6:76557297-76557319 ACTATCTCTTAGAAAAATGAAGG - Intergenic
1011513439 6:88126638-88126660 AGTATCTATAAAGGAAAAGGAGG + Intergenic
1012279149 6:97308743-97308765 ACAATCTATAATGAAAAAGATGG - Intergenic
1012280667 6:97324255-97324277 AGTACATATTAAGAAAGAGAAGG + Intergenic
1013816547 6:114105154-114105176 AAAATACATTAGGAAAAAGAAGG + Intronic
1016274645 6:142334790-142334812 AGTATCTTTTAATAAACAGAGGG + Intronic
1016276339 6:142357671-142357693 AGAATATATTGGGAAAAAGATGG - Intronic
1016729428 6:147412577-147412599 AGTATCTATCAATAAATAGATGG + Intergenic
1016959502 6:149658743-149658765 AGTTTCTATTACAAATAAGAAGG + Exonic
1017582758 6:155884533-155884555 AGTGTGTATAAGGAGAAAGATGG - Intergenic
1018081158 6:160260348-160260370 ACTATCCAATAGAAAAAAGAAGG - Intronic
1018175912 6:161179165-161179187 GGTTACTAATAGGAAAAAGATGG + Intronic
1018211770 6:161489148-161489170 AATTTCTATTAAGAAAAGGAAGG - Intronic
1018682184 6:166273685-166273707 TGTATATATTAGCAAAAAGAAGG - Intergenic
1020529409 7:9312047-9312069 AGTACCACTTAGGAAAAAGATGG + Intergenic
1020709006 7:11582384-11582406 AGTATTGCTTAGGAAAAAGGTGG - Intronic
1020947526 7:14631827-14631849 TGTATATATTATGATAAAGATGG - Intronic
1020961135 7:14803332-14803354 AGCATCACTAAGGAAAAAGAGGG - Intronic
1021528257 7:21613338-21613360 AATATGTAGTAGGGAAAAGAGGG + Intronic
1022174540 7:27860875-27860897 ACTGTCTCTTAGGAAAAAGGAGG - Intronic
1023124126 7:36938062-36938084 AGTATATTTTAGAAAAAGGATGG - Intronic
1026685778 7:72508978-72509000 ACAATCTATAAGTAAAAAGAAGG + Intergenic
1027531266 7:79336488-79336510 ATTATGTATAAGAAAAAAGAAGG + Intronic
1027691803 7:81356151-81356173 AGTATTTATTATGAAAAACTTGG - Intergenic
1029024341 7:97400103-97400125 AGAATGTATGAGGAAAAGGAAGG + Intergenic
1030766329 7:113414200-113414222 GGTATCTTTTAGGAAAAATATGG - Intergenic
1032244886 7:130202756-130202778 AGTTTTTATGAGGAATAAGAAGG - Intronic
1033373545 7:140735131-140735153 AGTCTCTTTTGGGAAGAAGATGG + Intronic
1034133743 7:148745609-148745631 AGTGACTATTAGGATGAAGATGG + Intronic
1035820698 8:2588660-2588682 AAATTCTCTTAGGAAAAAGAAGG - Intergenic
1036271374 8:7306522-7306544 AATAGCTATTATCAAAAAGATGG + Intergenic
1036349974 8:8003821-8003843 AATAGCTATTATCAAAAAGATGG - Intergenic
1036845244 8:12164335-12164357 AATAGCTATTATCAAAAAGATGG - Intergenic
1036866613 8:12406656-12406678 AATAGCTATTATCAAAAAGATGG - Intergenic
1038718655 8:30013643-30013665 ACTTTCTAATAGGAAAAACAAGG + Intergenic
1039192882 8:34997023-34997045 AGCATCTTTTAGGATAAAAAGGG - Intergenic
1041801737 8:61807754-61807776 ATAATCTCTTAGCAAAAAGAGGG + Intergenic
1041890801 8:62866094-62866116 AGTATTTTTAAAGAAAAAGAGGG + Intronic
1041891808 8:62877675-62877697 TTTATCCATTAGGAAAATGAAGG - Intronic
1042159686 8:65880265-65880287 AGAATCTATTAGGAAATATCAGG + Intergenic
1045608424 8:103805759-103805781 AATATCAATGAGGAAAAATAAGG - Intronic
1046384229 8:113487636-113487658 AGTATCTATTATGAATACAATGG - Intergenic
1046413658 8:113882208-113882230 ATTATCTATCAAGAGAAAGATGG + Intergenic
1046483732 8:114857775-114857797 AGAAGATATTATGAAAAAGAGGG + Intergenic
1047025831 8:120823515-120823537 AGTTTGTTTTAGGAAAGAGAGGG - Intergenic
1047420866 8:124707243-124707265 AGTATTTCTTAAGAAAAAGGTGG + Intronic
1049893987 9:96944-96966 AGTAATTATTAGGAGAAAGCAGG - Intergenic
1050185103 9:2965049-2965071 AGTAACTATGGGGAGAAAGAAGG + Intergenic
1051752180 9:20354160-20354182 AGAATGTATTACGAAAAACAGGG + Intronic
1052191799 9:25670906-25670928 AATATATATTAAGAATAAGACGG - Intergenic
1053735215 9:41097028-41097050 AGTAATTATTAGGAGAAAGCAGG - Intergenic
1054693165 9:68334369-68334391 AGTAATTATTAGGAGAAAGCAGG + Intronic
1055157574 9:73082885-73082907 AGTATATATTAAGACATAGAAGG - Intergenic
1056074543 9:83025012-83025034 AGCATGTATTGGGAAAGAGAGGG - Intronic
1057021038 9:91697767-91697789 AGCATCCTTTAGGAAAAAGCAGG - Intronic
1058178307 9:101764999-101765021 AGAAACAATTAGGACAAAGAGGG - Intergenic
1058286214 9:103182858-103182880 AATATCAATAAGGAAGAAGAGGG - Intergenic
1058544759 9:106049149-106049171 ATTATCCACTAGGACAAAGAAGG + Intergenic
1058586585 9:106513300-106513322 AGTATATATTGGGAAAATAAAGG - Intergenic
1060049805 9:120370233-120370255 AATACCTAGTAGGAAGAAGAAGG - Intergenic
1060380640 9:123167310-123167332 AGTATAAATTAGGAGAAAAAAGG + Intronic
1060760981 9:126248501-126248523 AGTATCTCCAAAGAAAAAGATGG - Intergenic
1061287142 9:129630477-129630499 AGCAACTATGAGGAAAGAGAAGG - Intronic
1186085585 X:5987072-5987094 CATATCTATTAGGAATAAAATGG + Intronic
1186410182 X:9339988-9340010 AGTAATTATTAAGAAACAGACGG - Intergenic
1186907234 X:14124577-14124599 AGTTGCTATGAGGAAAAAAAGGG + Intergenic
1186931059 X:14390744-14390766 AGTATCACTTAGCAATAAGACGG + Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187582208 X:20620199-20620221 AATATCTATGATGTAAAAGAAGG + Intergenic
1189502207 X:41572916-41572938 AGTATCTTTCAAGAACAAGAAGG - Intronic
1192712858 X:73609662-73609684 AGTATCAATTAGAGAAAACAAGG - Intronic
1193667815 X:84344802-84344824 AATATTTATTAGCAGAAAGAAGG + Intronic
1193674299 X:84430039-84430061 AGTATCAAATAGCTAAAAGAAGG - Intronic
1194683494 X:96883083-96883105 ATTATATATTAGGAAAAACATGG - Intronic
1194727632 X:97416906-97416928 AATTTCTCTAAGGAAAAAGAGGG + Intronic
1197854116 X:130896804-130896826 ATTATCTGTAAGGAAAATGAAGG + Intronic
1198151997 X:133920255-133920277 AGACTCAATTAGGAAAAAGGAGG + Intronic
1198241269 X:134788971-134788993 AGTATCAATTTGGAAGTAGAAGG + Intronic
1198766964 X:140090549-140090571 AGTCCCTTTTAGGAAAAAAAAGG - Intergenic
1199074340 X:143511925-143511947 AGTATCCAATAGGAAAGACATGG - Intronic
1199093343 X:143715192-143715214 AGTATCCAATAGGAAAGACATGG - Intronic
1199251067 X:145662310-145662332 AGTATCTAATAGGAAGAACCAGG - Intergenic
1199341219 X:146679496-146679518 GGGATCTATTAGGAAGCAGAAGG - Intergenic
1201510209 Y:14751173-14751195 TGTATCAATTAGGAATAAAATGG - Intronic
1201793989 Y:17874907-17874929 AGAATCCATTAGAAAAAAAAAGG - Intergenic
1201807565 Y:18031078-18031100 AGAATCCATTAGAAAAAAAAAGG + Intergenic