ID: 996925214

View in Genome Browser
Species Human (GRCh38)
Location 5:128817280-128817302
Sequence CTGTTTTCATAGATTGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2215
Summary {0: 1, 1: 1, 2: 35, 3: 423, 4: 1755}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996925214_996925216 0 Left 996925214 5:128817280-128817302 CCCAATTCAATCTATGAAAACAG 0: 1
1: 1
2: 35
3: 423
4: 1755
Right 996925216 5:128817303-128817325 TATTACCCTAATATCAAAATTGG 0: 1
1: 0
2: 14
3: 72
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996925214 Original CRISPR CTGTTTTCATAGATTGAATT GGG (reversed) Intronic
Too many off-targets to display for this crispr