ID: 996926253

View in Genome Browser
Species Human (GRCh38)
Location 5:128830000-128830022
Sequence AAACATGGACTGCTTTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996926251_996926253 -3 Left 996926251 5:128829980-128830002 CCAAAGCAGAGTAGTGGTACAAA 0: 1
1: 0
2: 1
3: 8
4: 118
Right 996926253 5:128830000-128830022 AAACATGGACTGCTTTTGATAGG 0: 1
1: 0
2: 0
3: 20
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996926253 Original CRISPR AAACATGGACTGCTTTTGAT AGG Intronic
900655568 1:3755111-3755133 AAACAGGGTCTGCCTTGGATGGG + Intronic
909136570 1:71808223-71808245 AAACATTTATTTCTTTTGATTGG - Intronic
909865006 1:80656781-80656803 ACACACGGAGTGCTTTTGATGGG + Intergenic
911167352 1:94735729-94735751 AAACCTGGGCTGCATTTGAAGGG + Intergenic
911280803 1:95925507-95925529 AAACATTGATTGCCTATGATAGG - Intergenic
911812695 1:102303639-102303661 AAATAAAGACTGCCTTTGATGGG + Intergenic
913421532 1:118675286-118675308 AAACATCCATTCCTTTTGATTGG + Intergenic
917730027 1:177865921-177865943 AAACATGAACATCTTTTGCTGGG - Intergenic
918477891 1:184945119-184945141 AAACTTCTACTGCGTTTGATTGG + Intronic
918721950 1:187863858-187863880 AAAGATGAACAGCTTTGGATGGG - Intergenic
922181657 1:223240583-223240605 AAACAAAGAATGCCTTTGATGGG - Intronic
922543681 1:226437978-226438000 AAAAATCGTCTGCTATTGATGGG + Intergenic
923368032 1:233282625-233282647 AATCATGGATAGATTTTGATAGG - Intronic
924407680 1:243768498-243768520 TAAAATGAACTGTTTTTGATAGG - Intronic
1064241905 10:13638345-13638367 AAACATGAACTGCTTTTTTAAGG + Intronic
1066125108 10:32334022-32334044 AAACATGTACTACCTTTCATGGG + Intronic
1067274401 10:44821347-44821369 ATACAGGTACTGCTTTTTATAGG - Intergenic
1070525249 10:77290742-77290764 ACACAATGACTGCTTTTGAAGGG + Intronic
1080030250 11:27652823-27652845 AAACATGGGCTGGTTTGGAGTGG + Intergenic
1080660434 11:34291836-34291858 ATATATGGGCTGCTTTTGGTTGG + Intronic
1082107612 11:48237328-48237350 AAACATACACTCCTTCTGATGGG - Intergenic
1082862025 11:57866206-57866228 AAACCAGGGCTGCTCTTGATTGG + Intergenic
1083355410 11:62062606-62062628 AAACATGGCCTGCTTCTCCTGGG - Intergenic
1084615068 11:70230368-70230390 AATCAAGAGCTGCTTTTGATAGG + Intergenic
1085698407 11:78725299-78725321 AAACATGCTGTGGTTTTGATGGG + Intronic
1087356942 11:97105965-97105987 AAATATGCACTGTTTTAGATAGG - Intergenic
1087566413 11:99864681-99864703 AAAAATCGACTTCTTTTGATAGG + Intronic
1088397688 11:109386706-109386728 AAACTTGCAGTGCCTTTGATGGG + Intergenic
1089090184 11:115866972-115866994 AAACAGGGAATCCTTTTGTTGGG + Intergenic
1089945002 11:122461707-122461729 AAACATGGACTGCTGCTGCTGGG + Intergenic
1092574299 12:9762674-9762696 AAATATGGAGTGCTATTTATTGG + Intergenic
1092678610 12:10951432-10951454 AAATCTTGAATGCTTTTGATAGG - Intronic
1092693322 12:11140928-11140950 AAACCTTGAATGCTTTTGGTAGG - Intronic
1092764121 12:11837147-11837169 ATCCATGGACTGTTTTTAATAGG + Intronic
1093140279 12:15502016-15502038 AACCACCCACTGCTTTTGATGGG + Exonic
1095313347 12:40727771-40727793 AAATATGCACTGAATTTGATAGG + Intronic
1098851797 12:75604665-75604687 AAGCATGGACTGCCTCTGCTTGG + Intergenic
1100355138 12:93821720-93821742 AAATCTGGACAGCTTTTGAGAGG + Intronic
1101632481 12:106508708-106508730 GAACATGGACTGTTGTTGCTAGG + Intronic
1102590586 12:113953799-113953821 CACCATGGTCTGCTTTTGAATGG + Intronic
1104174551 12:126317291-126317313 AAATATGTACAGCTTTTTATAGG - Intergenic
1105073841 12:133257255-133257277 AAACACGACATGCTTTTGATGGG + Intergenic
1107041467 13:35952781-35952803 ATAAATGGACTGTTTTTCATTGG - Intronic
1107775198 13:43832187-43832209 TAACATGGGCTGTTTTTGACAGG + Intronic
1109575568 13:64252255-64252277 AAATAAAGAATGCTTTTGATTGG + Intergenic
1110306820 13:73997563-73997585 TATCATGGCTTGCTTTTGATAGG - Intronic
1110786947 13:79539105-79539127 TAACATAGTCTGCTGTTGATGGG + Intronic
1114184608 14:20391065-20391087 AACTATGCACTGCTGTTGATTGG - Exonic
1115443606 14:33464043-33464065 AAAAAAGGGCAGCTTTTGATGGG - Intronic
1115503527 14:34071382-34071404 CAACATGGATTACTTTTGAAAGG + Intronic
1116196273 14:41730185-41730207 AAAAATAGACTGCTTTTAAATGG + Intronic
1117165360 14:53027611-53027633 AAACAAGGAATGCTTGTGTTGGG + Intergenic
1118387465 14:65268149-65268171 AAACATGGAATGAGTTTGCTAGG + Intergenic
1119793346 14:77374237-77374259 AAACTTGGAATTCGTTTGATTGG - Intronic
1120074415 14:80139397-80139419 AAACATGGACTCCTACTCATGGG + Intergenic
1123899875 15:24865439-24865461 AAACATGGACTGGGTCTGACTGG - Intronic
1124082247 15:26511928-26511950 AAATAAAGAATGCTTTTGATGGG - Intergenic
1124511394 15:30329279-30329301 AAACATGAACTGCTCTTGGATGG + Intergenic
1124731520 15:32201485-32201507 AAACATGAACTGCTCTTGGATGG - Intergenic
1125999690 15:44196818-44196840 TAACCTGGACTGCTCTTAATTGG + Intergenic
1127337377 15:58001840-58001862 AAAAAAGGACTGCATTTGATGGG + Intronic
1129573723 15:76717955-76717977 AAAAATGTATTGCTTTTGATGGG - Intronic
1133176736 16:4021164-4021186 ATACATGTGCTGCTTTTAATGGG - Intronic
1135112459 16:19700998-19701020 AATCAAGAGCTGCTTTTGATAGG - Exonic
1136509597 16:30728526-30728548 AAACCTGGTCTGGATTTGATTGG + Intronic
1143253227 17:5537781-5537803 AAACCTGGGCTGCTTCTGAGGGG - Intronic
1144718030 17:17447709-17447731 AGACATGGACATCTTTTGAGAGG - Intergenic
1146765788 17:35520309-35520331 AACCATGGACTGCTTCTGGCTGG + Intronic
1148614866 17:48994601-48994623 AAAAGTGGACTGCATTTTATAGG + Intergenic
1150998310 17:70344764-70344786 AAACATTCGCTGCTTTTGAAAGG - Intergenic
1151965089 17:77427053-77427075 TGACATGGACTGCTCGTGATTGG + Intronic
1156813486 18:41280542-41280564 GACCATGGACTGCTTTTGGCAGG - Intergenic
1157177154 18:45462096-45462118 AAACATTGATTGGTTTTGTTTGG - Intronic
1157377748 18:47181973-47181995 TAAAATGGAGTGCTTTTAATAGG - Intergenic
1157973711 18:52300553-52300575 AATCATAGACTAGTTTTGATGGG - Intergenic
1161795568 19:6384516-6384538 AAAAAAGGACTGCATTTAATAGG + Intronic
1165971113 19:39630696-39630718 AAACATGAAATGCTTTCGTTTGG + Intergenic
1167857248 19:52252644-52252666 AACCATGGACTGCTTCTGGTGGG - Intergenic
925753956 2:7115968-7115990 AAGCACTGACTTCTTTTGATTGG - Intergenic
939110894 2:138005701-138005723 ACAAATGAACTGTTTTTGATAGG - Intronic
939341244 2:140898232-140898254 AAAAATGGACAGCTTTTCCTGGG + Intronic
939755651 2:146106009-146106031 AATCATGTATTGTTTTTGATAGG + Intergenic
940096010 2:149976430-149976452 AAACTTGCCTTGCTTTTGATGGG + Intergenic
940714011 2:157197634-157197656 AAATAAAGAATGCTTTTGATAGG + Intergenic
942340583 2:174941271-174941293 AAACATTGCCTCCTTTTGGTGGG + Intronic
943994812 2:194748898-194748920 AAACATGGTTTGATTTTGAGCGG - Intergenic
944088841 2:195881834-195881856 AAATATTGAAGGCTTTTGATGGG + Exonic
946588644 2:221218907-221218929 AAACACGAGCTTCTTTTGATGGG - Intergenic
1169915073 20:10675148-10675170 AAACATCGACTTCCTTTGAAGGG + Intergenic
1172276813 20:33684598-33684620 AAAAAGGGACTGCTGCTGATGGG + Intronic
1172825276 20:37777747-37777769 ATACATGGTCTGCTTTGAATGGG + Intronic
1173919636 20:46733954-46733976 AAAGGTGGTCTGCTTTTGCTGGG + Exonic
1174234345 20:49076479-49076501 AAACATGAACTGCTTAGGCTAGG - Intronic
1174753072 20:53131497-53131519 AATGATGGGCTGCATTTGATGGG - Intronic
1176276652 20:64275138-64275160 AAACATGTATTGCTCTAGATTGG + Exonic
1178434545 21:32546439-32546461 AAACATGGACTGGAGTGGATTGG - Intergenic
1178635647 21:34300040-34300062 AAAGATGGACTGGTTTTGTTAGG - Intergenic
1182742028 22:32574775-32574797 ACAGATGGGCTGCTTTAGATGGG - Intronic
1182771269 22:32798151-32798173 AAACCTGTATTGCTTCTGATTGG + Intronic
1183508450 22:38221881-38221903 AAAAATGGACTTCTTTGGCTGGG + Intronic
949282179 3:2359430-2359452 AAACATGGAGGGATTTTTATTGG + Intronic
949622745 3:5833651-5833673 AAACATCGATTGATTTTCATAGG + Intergenic
949802413 3:7918103-7918125 AGACATGGAGTGCATTTGCTGGG - Intergenic
950803202 3:15572276-15572298 AAACATGGAAGGCTTTTGTTTGG + Intronic
950803211 3:15572348-15572370 TAACATGGAAGGCTTTTGTTTGG + Intronic
952314929 3:32224315-32224337 AAACCTGAACTGGTTTTGACGGG + Intergenic
954352860 3:50059848-50059870 TAACATGGACTGCTTCAGATAGG + Intronic
954939279 3:54356147-54356169 AAATTTGGACAGCTTTTGACAGG + Intronic
955599850 3:60633576-60633598 AAATTTGGACTGCTTTTATTTGG - Intronic
956201620 3:66712110-66712132 AACTGTGGACTGCTTTTCATTGG - Intergenic
956983959 3:74675047-74675069 AAATATGTTCTGCTTTTAATAGG - Intergenic
956997263 3:74841818-74841840 AAACATGTCCTGCTTTTAATAGG + Intergenic
957546049 3:81638688-81638710 AAACATGGGCAGCTCCTGATTGG + Intronic
957654189 3:83050794-83050816 AAACAAAAACTGCTTTTGATGGG - Intergenic
960055195 3:113272209-113272231 AAACAAGGACTGCTTCTGCAGGG - Intronic
961091718 3:124118358-124118380 AAACAGGGAATGCTTTTCTTAGG + Intronic
961527806 3:127518241-127518263 GAACATATGCTGCTTTTGATAGG - Intergenic
962001177 3:131299042-131299064 AAACAAAGAATGCCTTTGATGGG - Intronic
963646608 3:147923027-147923049 AAGGATGGACTCCTCTTGATGGG - Intergenic
965196208 3:165598598-165598620 AAGCATGAACTGCATTTGAAGGG - Intergenic
966213969 3:177481974-177481996 AAACATTGCCTACATTTGATAGG - Intergenic
966699544 3:182832058-182832080 AAATATGGACTGCATTTAACTGG + Intronic
967288564 3:187897344-187897366 AAAAGTGGACTGCTTTTATTGGG - Intergenic
970068127 4:12122697-12122719 GAAGATGGACTGCTTTTCAGAGG + Intergenic
971876543 4:32316236-32316258 AAACATGGAGTTCTTTTGAGGGG - Intergenic
974439368 4:61897471-61897493 AACCATGGATAGCTTATGATTGG + Intronic
974685104 4:65217137-65217159 GCACTTGGACTGCTTATGATTGG - Intergenic
975397403 4:73892934-73892956 AAACATTGACTTATTTAGATGGG + Intergenic
976045525 4:80942067-80942089 GAACATGGATGGTTTTTGATGGG + Intronic
977078414 4:92489419-92489441 AATTATTGAATGCTTTTGATTGG + Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978602024 4:110438748-110438770 AAACATGGGCTGGTTATGTTTGG - Intronic
979578497 4:122325061-122325083 AAACATTGACTCTTTTTTATGGG + Intronic
979661910 4:123265696-123265718 AAACATGGAAGCCTTTTTATAGG + Intronic
981477786 4:145205717-145205739 AAAAATGGACTTCTTTGGGTAGG + Intergenic
981810526 4:148769052-148769074 AAAACTGGAATGCTTATGATGGG + Intergenic
981947444 4:150364552-150364574 TAACATGGATTACTTTTCATTGG + Intronic
987163135 5:15165985-15166007 AAACATGGGCTACTTTTAATGGG + Intergenic
987261406 5:16207557-16207579 AAACATACAGTGCTTATGATAGG + Intergenic
987859053 5:23460253-23460275 AGACATGGAGTGGTTTTGATTGG + Intergenic
989339431 5:40356432-40356454 AAGCTTGGACTGTTGTTGATTGG - Intergenic
989339997 5:40363475-40363497 AAAAGTGAACTGCTTCTGATGGG - Intergenic
989571485 5:42950321-42950343 TAACATGTACTGGTTTAGATCGG - Intergenic
990855199 5:60258427-60258449 AAATATTGACTGATTTTAATGGG - Intronic
992232368 5:74676106-74676128 AAACAAAAACTGCTATTGATAGG - Intronic
995723259 5:115158991-115159013 TAACATTGACTGCTTTTTAATGG - Intronic
995725551 5:115178278-115178300 ATAAATGGACTACTCTTGATAGG - Intronic
996301100 5:121986800-121986822 AAACTTGGATAGTTTTTGATTGG + Intronic
996926253 5:128830000-128830022 AAACATGGACTGCTTTTGATAGG + Intronic
1001510176 5:172315025-172315047 ATACCTGGACTGCTTTTGGAAGG + Intergenic
1001726566 5:173907383-173907405 AAATATAGACTGGTTTTGTTTGG - Intronic
1003196813 6:3921827-3921849 CATCATGGGGTGCTTTTGATGGG - Intergenic
1003798026 6:9628337-9628359 AACCATGGACTGGTTTTGGTTGG - Intronic
1003812865 6:9804153-9804175 CAACATGGTCTGGTTTTGGTGGG - Intronic
1004543999 6:16579308-16579330 AAACAGTGACCGCTTTTCATAGG + Intronic
1005253597 6:23975712-23975734 AAACATGCATTGATTTTGAAAGG + Intergenic
1007899017 6:45392988-45393010 AAATAAAGAATGCTTTTGATGGG - Intronic
1008073923 6:47126309-47126331 AAATACGGATTGCTTTTGATAGG - Intergenic
1009561634 6:65252622-65252644 AAACATGGGCATCTATTGATTGG - Intronic
1010927609 6:81762975-81762997 AAGTATGGGCTGCTTTTAATGGG - Intergenic
1014157973 6:118134196-118134218 AAAGATGAACTGCTTCTGGTGGG + Intronic
1014296340 6:119622417-119622439 AGACATGGTCTGCATTTGACAGG - Intergenic
1015018316 6:128441255-128441277 AAACATGGAATGCTTTTCAGAGG - Intronic
1015051746 6:128849214-128849236 AAACATAGAATGTTTTTGATGGG + Intergenic
1015664550 6:135613659-135613681 CAAAATGGACTGATTTTGGTTGG - Intergenic
1017306662 6:152926133-152926155 AAACATTTATTGCTTTTGAACGG - Intergenic
1020854197 7:13396498-13396520 AAACATGGAATGGTTTTGGTGGG + Intergenic
1021657942 7:22890419-22890441 AAAAATGGAATCCTTTTGGTTGG - Intergenic
1022454184 7:30543947-30543969 AATCATGGGCTGCTTTGCATAGG + Intronic
1023600253 7:41875439-41875461 AAACAGGGGGTGCTTTTGTTGGG - Intergenic
1027600028 7:80228445-80228467 GAACATGGACAACTTTTGGTGGG + Intergenic
1031061182 7:117053371-117053393 AAACACGGACTACTCTTGTTAGG + Intronic
1032260773 7:130334914-130334936 AAACAAAGAATGCCTTTGATGGG + Intergenic
1032897051 7:136263116-136263138 AATCATGGGCTGCTTTGCATAGG - Intergenic
1033130132 7:138738843-138738865 AAACATGGACAGCATTTGCCAGG + Intronic
1033929425 7:146505096-146505118 CAACATGGGCAGCTTTGGATAGG - Intronic
1033944445 7:146698911-146698933 AAATAAAGACTGCTTTGGATGGG - Intronic
1034697169 7:153064039-153064061 ACACATGGAATGCTATTGAGAGG + Intergenic
1034948951 7:155284177-155284199 AAACATGATTTGGTTTTGATGGG - Intergenic
1035427269 7:158787755-158787777 AAACATGGACTTCTTCAGAAGGG - Intronic
1038995103 8:32913993-32914015 AAAGATGGCTTGATTTTGATGGG - Intergenic
1041003259 8:53472401-53472423 ACACAAGGACTGTTTTTGAGAGG - Intergenic
1041101535 8:54400704-54400726 AAACATGGAGAGATTTTCATGGG - Intergenic
1043137430 8:76545900-76545922 AAAAGTTGGCTGCTTTTGATTGG - Intergenic
1043221036 8:77664085-77664107 AAATAAAGAATGCTTTTGATGGG + Intergenic
1044393479 8:91681132-91681154 AAACTTGGATTGCTGTTGCTGGG + Intergenic
1044973421 8:97642004-97642026 AAATAAGGACTGCTTTTTCTGGG - Intergenic
1046456273 8:114467527-114467549 CAACATAGACTGATTTTCATAGG - Intergenic
1047538929 8:125745178-125745200 AAACAGGGACTGCTTATTTTGGG - Intergenic
1047567425 8:126061177-126061199 AAACACAAACTGCTTTTGAAGGG - Intergenic
1047818547 8:128492696-128492718 AAAAATGAACTGCTTTTCCTGGG + Intergenic
1049908543 9:243286-243308 AAACATGCACTGGTTTTAAGGGG - Intronic
1050195670 9:3080658-3080680 ACACATGAGCTGCTTCTGATTGG - Intergenic
1050728470 9:8679125-8679147 AAAGATGGAATCCTTTTTATAGG - Intronic
1052783369 9:32803858-32803880 AAATAAAGAATGCTTTTGATGGG + Intergenic
1058042962 9:100324421-100324443 AAAAAGGGACTACTTTAGATGGG + Intronic
1058119791 9:101126001-101126023 AATCATGGGCTGCTTTGCATAGG - Intronic
1058222612 9:102320962-102320984 TAATAAGGAATGCTTTTGATGGG + Intergenic
1060045495 9:120337037-120337059 AAAGAAGGACGGCATTTGATAGG + Intergenic
1185651307 X:1649923-1649945 AAACAAGGACTCATTTTGACTGG - Intergenic
1187258641 X:17664740-17664762 AAGCATGGTATGATTTTGATTGG + Intronic
1195307249 X:103596038-103596060 AAACAAGGAATGCCTTTGATAGG - Intergenic
1197699238 X:129585324-129585346 GAACATGGACTGCTCTTAACAGG - Intronic
1201017030 Y:9615161-9615183 GAAGATGGACTTCTTTTAATTGG + Intergenic
1201988901 Y:20002781-20002803 AAAAATGGACTGAAATTGATAGG - Intergenic