ID: 996930351

View in Genome Browser
Species Human (GRCh38)
Location 5:128879027-128879049
Sequence TAAGGTAAGCAGAGAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996930351 Original CRISPR TAAGGTAAGCAGAGAGATGC AGG Intronic
900003697 1:29805-29827 TCAGGTAGGCTGAGAGACGCAGG - Intergenic
900023417 1:200321-200343 TCAGGTAGGCTGAGAGACGCAGG - Intergenic
900662469 1:3791750-3791772 TAAAGAAAGGAGAGAGAGGCCGG - Intronic
901413911 1:9104159-9104181 TAAGGGTAGCAGTGAGATTCGGG - Exonic
902961590 1:19967340-19967362 TAAGGCAAGCATACAGAGGCAGG - Intergenic
903017737 1:20372306-20372328 TAAGGTAAACAGAGTCATACAGG + Intergenic
905265932 1:36754397-36754419 AAAGCTGAGCAGAGAGATGAAGG - Intergenic
905346352 1:37313575-37313597 CAAGGCAAACAAAGAGATGCTGG - Intergenic
913476691 1:119244892-119244914 TATGGTAAGGAGAGAGATGATGG - Intergenic
916440296 1:164818397-164818419 TAAGCTAAACAGAGAAATGTGGG + Intronic
916869109 1:168893280-168893302 TCAGATAAACAGAGAGATGAAGG + Intergenic
918221860 1:182442681-182442703 TGAGGGATGCAGAGACATGCAGG - Intergenic
918602353 1:186378235-186378257 TAAGGCTACCAGAGATATGCTGG - Intronic
918936434 1:190928270-190928292 TTAGAAAAGCAGAGAGATGATGG - Intergenic
919342899 1:196336498-196336520 TAAGGAAGGCAGAGAGATTGAGG - Intronic
919758038 1:201078127-201078149 GAAGGGAAGGAGAGTGATGCCGG - Intronic
919828375 1:201520281-201520303 GAAGGTAATCACAGAGATACTGG - Intergenic
919908130 1:202092346-202092368 TAACCTAAGCAAAGAGATGAGGG - Intergenic
919924701 1:202186334-202186356 AAAGGTAAGCAGGGAGCTGGGGG - Intergenic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
922628841 1:227083145-227083167 AAAGGCAAGGAGAGAGATGGTGG - Intronic
922994834 1:229947630-229947652 TAAGATAATCACAGAGATTCTGG - Intergenic
923136386 1:231123880-231123902 TAGGGTAGACTGAGAGATGCTGG - Intergenic
923869614 1:237976688-237976710 TAAAGGCAGCAGAGAGCTGCTGG - Intergenic
924189763 1:241538260-241538282 GAAGGAAAGAAGAGAGTTGCAGG - Intronic
924504416 1:244667808-244667830 TTAGGATAGCAGAGAGAAGCAGG + Intronic
1063102726 10:2964439-2964461 TAAGGTAAGAAGAGAGGTGTGGG - Intergenic
1064228828 10:13511554-13511576 AAAGTCAAGCAGGGAGATGCTGG + Intronic
1064915055 10:20447686-20447708 TGAGGAAAGCAAAGAGTTGCTGG + Intergenic
1067745589 10:48933378-48933400 AAAGGGCACCAGAGAGATGCTGG - Intronic
1068815073 10:61300365-61300387 TGTGGTAAGCAAAAAGATGCGGG - Intergenic
1071854250 10:89607281-89607303 TGAGGTAGGGAGAGAGATGGGGG + Intronic
1076507933 10:130990319-130990341 TAATTAAAGCCGAGAGATGCTGG - Intergenic
1077494299 11:2878949-2878971 TAAGGTAAGCTGACAGAGACAGG - Intergenic
1077664982 11:4099699-4099721 TAATGTAGGCAGTGAGAAGCAGG + Intronic
1078486234 11:11725888-11725910 TAAGGTATGAAGATAGAGGCTGG - Intergenic
1079324348 11:19478776-19478798 TTGGGACAGCAGAGAGATGCTGG - Intronic
1080240499 11:30121951-30121973 GCAGGTAGGCAGAGAGAGGCCGG - Intergenic
1080384097 11:31800219-31800241 AAAGGTGAGCAGGGAGATGCAGG - Intronic
1080678872 11:34454514-34454536 TAAGATAAGCAGAAAGAAGTGGG + Intronic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1082756987 11:57086995-57087017 TAGGCTAAGCAAAAAGATGCTGG - Intergenic
1082846429 11:57729551-57729573 TAAGGTAAGAAGAGAAAGTCTGG - Intronic
1083306002 11:61762329-61762351 GAAGGGAAGGACAGAGATGCTGG + Intronic
1083707936 11:64529595-64529617 CAAGGCAACCAGCGAGATGCAGG - Intergenic
1086531101 11:87786074-87786096 TTTGGTAAGCTGTGAGATGCAGG - Intergenic
1087760872 11:102103293-102103315 AGAGGTAAGGAGAGAGATGTTGG - Intergenic
1089633032 11:119795145-119795167 AAAGGAAAGCTCAGAGATGCCGG - Intergenic
1089762372 11:120737579-120737601 TAAGGAAAGGAAAGAGATGAAGG + Intronic
1090261603 11:125324953-125324975 TAAGGAAAGTAGAGACAGGCAGG + Intronic
1090393042 11:126401877-126401899 TGAGGGAAGGAGGGAGATGCAGG + Intronic
1090603853 11:128401144-128401166 GAAGCTAAGCAGGGAGCTGCAGG + Intergenic
1091377116 12:31859-31881 TCAGGTAGGCTGAGAGACGCAGG - Intergenic
1091409089 12:227511-227533 GAAGGACAGTAGAGAGATGCAGG + Intronic
1093840355 12:23891535-23891557 TAAATAAAGAAGAGAGATGCTGG - Intronic
1094010615 12:25805360-25805382 TAGGCTAAGCAAAAAGATGCTGG + Intergenic
1095952295 12:47788189-47788211 TAGGGAAGGCAGAGAGATGGGGG + Intronic
1096263271 12:50105834-50105856 TTAGGAAAGCAGTGAGGTGCTGG + Intronic
1098224943 12:68311743-68311765 GAAGGGAAGCAGAGTAATGCAGG - Intronic
1098600813 12:72329927-72329949 TAAGGGAATCAGAGAGATGAGGG + Intronic
1101356922 12:103987920-103987942 TAGGCTAAGCAAAAAGATGCTGG + Exonic
1101655684 12:106718004-106718026 TAAGGTAAGCTGAGCATTGCCGG - Intronic
1102032018 12:109745241-109745263 AAAGGGAAACAGTGAGATGCAGG - Intronic
1102224435 12:111217886-111217908 TCAGGAAATCAGAGAGATGGTGG + Exonic
1106573014 13:30946388-30946410 TAAGCTACTCAGAGAGATACCGG - Intronic
1106830067 13:33571446-33571468 TAAGGTATGCAGAAAAATGCAGG - Intergenic
1106890613 13:34241777-34241799 TAAGGAAAGGAGAGAGACCCTGG - Intergenic
1110356327 13:74571952-74571974 TAAGAGAAGCAGAAAGATGCAGG + Intergenic
1111117528 13:83800081-83800103 TAAGGAGAGCAGAGAATTGCTGG - Intergenic
1112603666 13:100882078-100882100 GAAGGGAAGCAGAGAAAGGCTGG - Intergenic
1113080086 13:106510468-106510490 TAAAGTAAGAAGAGAGACTCTGG + Intronic
1114998640 14:28392894-28392916 CAATGTAAACAGAGAGATACTGG - Intergenic
1117652787 14:57924300-57924322 GAAGGCAAGCAGATGGATGCTGG - Intronic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1118504043 14:66391328-66391350 TCAAGTAAGGAGAGAGAAGCTGG + Intergenic
1119858951 14:77922935-77922957 TTAGGAAAACAGAGAGATGAGGG + Intronic
1120030020 14:79630782-79630804 AATTGTAAGCAGAGAGATGGAGG - Intronic
1121743922 14:96273209-96273231 TAAGGTAAGCATAGAGTTAAAGG + Intergenic
1121774147 14:96579096-96579118 GGAGGTGAGCAGTGAGATGCTGG - Intergenic
1122519576 14:102333987-102334009 TCAGGTAAGGAGAGGGATGTGGG - Intronic
1126967567 15:54072645-54072667 TAAGGTAGGCAGAGATAAGATGG + Intronic
1128053470 15:64683009-64683031 TAAGGAGAGCAGAGAAATGTTGG - Exonic
1129833784 15:78688760-78688782 AAAGGTTATCAGAAAGATGCAGG - Intronic
1132431685 15:101766341-101766363 AAAAGCAAGCAGAGAGAAGCAGG - Intergenic
1132449805 15:101961135-101961157 TCAGGTAGGCTGAGAGACGCAGG + Intergenic
1133923706 16:10177867-10177889 GAACGTAGGCAGAGAGAAGCCGG - Intronic
1134124935 16:11610085-11610107 TCAGGGAAGCACAGAGAAGCTGG + Intronic
1134862644 16:17574457-17574479 TGAGGGAAGCAGTGAGATGCAGG - Intergenic
1135699075 16:24615678-24615700 TAAAGTGAGCAGAGGGTTGCTGG + Intergenic
1138026160 16:53523910-53523932 TGAGGTAGGCAGAGAGAAGGAGG - Intergenic
1139586969 16:67910224-67910246 GCAGAGAAGCAGAGAGATGCAGG + Intronic
1142875239 17:2848479-2848501 GAAGGAAAAGAGAGAGATGCAGG - Intronic
1143828191 17:9629975-9629997 TAAGGTAAGCCCAGAGCTCCTGG - Intronic
1144013265 17:11170402-11170424 AAAGGAAAGCTGAGAGTTGCTGG + Intergenic
1149571492 17:57675441-57675463 TGAGGAAAGCATAGAGATTCTGG - Intronic
1150444106 17:65215212-65215234 AGAGGAAAGAAGAGAGATGCTGG + Intronic
1155219649 18:23672499-23672521 GAAGGTAATCACAGAGATACTGG + Intergenic
1156480940 18:37435993-37436015 AGAGGTGAGCAGAGAGGTGCGGG - Intronic
1157409499 18:47451997-47452019 TAAGGGAAGCAGAGAGAGAGAGG - Intergenic
1158134532 18:54191820-54191842 AAAGGTAAGCAGAGACATTGGGG - Intronic
1158253661 18:55519716-55519738 TATGCTAAGCAGGGAAATGCAGG - Intronic
1159253431 18:65912181-65912203 AAATGCAAGCAGAGAGAGGCTGG + Intergenic
1160635450 19:71412-71434 TCAGGTAGGCTGAGAGACGCAGG - Intergenic
1160682034 19:416369-416391 AGAGGTAACCAGAGAGATGCGGG + Intergenic
1161614162 19:5260826-5260848 TAAGGGAAGCAGAGAGAACCAGG + Intronic
1161860126 19:6791801-6791823 CAAGGAAAGCTGAGAGCTGCAGG + Intronic
1163794046 19:19325771-19325793 GAAGAAGAGCAGAGAGATGCCGG - Intronic
1165091170 19:33389117-33389139 TAAGGTAACCAGAAACAGGCTGG + Intronic
1167373891 19:49101159-49101181 TAAAGAAAGAAGAGAGATGAAGG - Intronic
926512205 2:13795646-13795668 TAAGGAAAAAAGAGAGAGGCTGG - Intergenic
926550192 2:14292250-14292272 TAAGGTAATAGGAGAGATTCAGG + Intergenic
926727028 2:16006521-16006543 TATGGGAAGCAGAGATGTGCTGG + Intergenic
929608206 2:43249825-43249847 TATGGTCACCACAGAGATGCTGG - Intronic
930034927 2:47079408-47079430 TGAGGTAGGCAGAGGGAAGCGGG + Intronic
930784799 2:55261275-55261297 TAAGGCCAGCAGAGAAATACTGG - Intronic
931872458 2:66476112-66476134 TAATGGAACCAGAGAGATTCAGG + Intronic
932396828 2:71454350-71454372 AAAGGTGAGAGGAGAGATGCTGG - Intronic
933821708 2:86118408-86118430 TTTGGGAAGCAGAGAGATGTAGG - Intronic
934789433 2:97046201-97046223 TAAGGACAGCAGGGAGATGAGGG + Intergenic
934817039 2:97336339-97336361 TAAGGACAGCAGGGAGATGAGGG - Intergenic
934820657 2:97372145-97372167 TAAGGACAGCAGGGAGATGAGGG + Intergenic
936577341 2:113667772-113667794 GAAGGTGAGCAGAGAGAGGGTGG + Intergenic
937713349 2:125003799-125003821 TTAGGTTAGCAGATTGATGCTGG + Intergenic
938181873 2:129191412-129191434 TAAGGGAACCAGAGACATGTAGG + Intergenic
940313264 2:152301685-152301707 TAAGGTTAGCAAAGAGATCAAGG + Intergenic
941377248 2:164746879-164746901 AAAGTAAAGCAGAGAGATGGGGG - Intronic
941462078 2:165783510-165783532 TAATGGAAGCTGAGAGATGGAGG - Intronic
942154741 2:173116407-173116429 TAGGGAATGCAGGGAGATGCTGG - Intronic
942528252 2:176879586-176879608 TAGGGTGAGCAGAGAGGAGCAGG + Intergenic
942998146 2:182290552-182290574 TCAGGCAAGCAGAGGGAGGCTGG - Intronic
943388576 2:187232788-187232810 CAAGGTAAGGAAGGAGATGCAGG + Intergenic
944565024 2:200981235-200981257 AAAGGTAAGCAGAAAGATGAGGG + Exonic
944934545 2:204554211-204554233 TACTGTAAGCAGAGAGAGACAGG - Intronic
946135945 2:217646987-217647009 TAAGGAATGCAGAGAGAGGAAGG - Intronic
947455031 2:230246182-230246204 TAAGGAAAGCAGGAAGAAGCTGG - Intronic
947702846 2:232249592-232249614 TTGAGTAAGCAGAGTGATGCCGG + Intronic
948550488 2:238769117-238769139 TATGCTAAGCAGAGACATGGAGG - Intergenic
1168936412 20:1669687-1669709 TAAAGGAGGAAGAGAGATGCAGG - Intergenic
1169696171 20:8389326-8389348 TAAGGTAATAGGACAGATGCTGG - Intronic
1170700428 20:18698697-18698719 GAGGGTAAGGAGACAGATGCAGG - Intronic
1170858458 20:20079490-20079512 GAAGGGAAGCAGAGAGAGGGAGG + Intronic
1171302427 20:24075412-24075434 GAAGCTGAGCAGATAGATGCTGG - Intergenic
1175250186 20:57604489-57604511 TAAGGAATGCAGAGAGCAGCAGG + Exonic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175801166 20:61801747-61801769 GAAAGAAAGCAGAGAGAGGCTGG - Intronic
1177125956 21:17193143-17193165 TAAGGTAGGGAGAGAGGAGCAGG - Intergenic
1179262034 21:39765821-39765843 TAAGGTAAGCAGATCCATGCAGG - Exonic
1180561887 22:16623020-16623042 TCAGGTTAGAAGAGGGATGCTGG + Intergenic
1182904922 22:33927336-33927358 TAACCTCAGCAGAGAGTTGCAGG + Intergenic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184605874 22:45574609-45574631 GAAGGTAGGCAGCGAGATGACGG - Exonic
1185192929 22:49450202-49450224 CAAGGGAAGCAGAGAAATGCAGG + Intronic
949347189 3:3087397-3087419 TAAGGTGAGCTGGGAGAGGCTGG - Intronic
949403789 3:3693694-3693716 GCAGAGAAGCAGAGAGATGCAGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950886619 3:16367971-16367993 GAAGGTGTGCAGAGAGGTGCTGG - Intronic
951778168 3:26333581-26333603 CAAGGTACTCAGAGAAATGCTGG - Intergenic
957126038 3:76162096-76162118 TAAGTTATGCAGAGAGATTTTGG + Intronic
958159079 3:89793242-89793264 CAAGGCAAACAGAGAGATCCAGG - Intergenic
958923075 3:100127667-100127689 TTATGTAAGCAGTGAGATGATGG - Intronic
959426627 3:106197760-106197782 TAAAGAAAGAAGATAGATGCTGG - Intergenic
960155344 3:114292738-114292760 TTGGGTAGGCAGAGAGAAGCTGG + Intronic
960839343 3:121940557-121940579 TGTGGGAAGCAGAGAGATGGGGG - Intronic
961993907 3:131220749-131220771 TTAGATATGCAGAGAGAGGCAGG + Intronic
962070893 3:132033497-132033519 AAAGGTGAGCAGAGTGAGGCGGG - Intronic
962475688 3:135753159-135753181 TGAGGGAAGCACAGAGAAGCAGG + Intergenic
963806718 3:149730006-149730028 AAAGCGAAGCAGAGAGATACTGG + Intronic
963972963 3:151449828-151449850 TAAGAGAAGCAGATGGATGCAGG + Intronic
964046607 3:152335748-152335770 TAAGTTAATCATAGAGATGTAGG + Intronic
964727290 3:159826651-159826673 TAAGGGGAGAAGAGAGATGTTGG + Intronic
966924946 3:184638610-184638632 GAAGGTGAGCAGAGAGAGGTTGG + Intronic
969179614 4:5427922-5427944 CAAAGTAAGCAGAGAGAAGGAGG - Intronic
969496231 4:7527800-7527822 TAAGGTGAGCAGGGAGATGTAGG + Intronic
970288858 4:14549942-14549964 TAACGTGAGCAGAGAAATGAAGG - Intergenic
972409335 4:38777154-38777176 TAAGGGAAACAGAGAGAGACTGG + Intronic
973558739 4:52112678-52112700 GAAGATAAGGAGAGAAATGCTGG - Intergenic
973971670 4:56219117-56219139 TAAGGTAAGAAGAGAACTGGGGG - Intronic
975904870 4:79197400-79197422 CATGGTAAGAAGATAGATGCAGG - Intergenic
976132962 4:81904511-81904533 TAAGGTAAGGTGAGTGAGGCAGG - Intronic
976771271 4:88655614-88655636 TAAGATGAACAGAGAGAAGCAGG - Intronic
979132154 4:117060557-117060579 GAAGGTAAACAGAGTGATGAAGG - Intergenic
979338445 4:119491077-119491099 GAAAGAATGCAGAGAGATGCTGG + Intergenic
979762445 4:124423369-124423391 AAAGATAAGCACACAGATGCAGG + Intergenic
982557019 4:156880089-156880111 TAAGCTAAGCTGACAGATGAAGG + Intronic
987485352 5:18519275-18519297 TTAGGTAGGCACAGTGATGCAGG + Intergenic
987646633 5:20680925-20680947 TAAGGAAAGCAGAGAGAAGGTGG - Intergenic
989178416 5:38553077-38553099 AAAGGAAAGGAGAGAGCTGCAGG - Intronic
990032194 5:51275479-51275501 GAAGGTAATCACAGAGATACTGG - Intergenic
990288283 5:54322736-54322758 AAAGGGCAGCAGAGAGATGATGG + Intergenic
991294173 5:65063202-65063224 CTAGGTAAGCAGAGAGATGCTGG - Intergenic
991366842 5:65877434-65877456 TAAGGAAAGGTGAGAGATGAAGG - Intergenic
992388939 5:76312707-76312729 GAAGGTAGGCAGAGAAAGGCAGG - Intronic
992406914 5:76467948-76467970 TAGGGGAAGAAGAGAAATGCTGG + Intronic
993596932 5:89869122-89869144 TAAGCTCAGCAGAGAGTTGAGGG - Intergenic
994178977 5:96743390-96743412 GAAGGAAAGGAGAGAGTTGCCGG + Intronic
995105141 5:108369080-108369102 TTAGGTGAGCAGAGGGATGATGG - Intronic
995256104 5:110048639-110048661 TGAGGTCAGCAGAGAGGTGGGGG - Intergenic
996730243 5:126710421-126710443 TAAAGTAAGCAGTGAGAGGTGGG - Intergenic
996930351 5:128879027-128879049 TAAGGTAAGCAGAGAGATGCAGG + Intronic
997029245 5:130104566-130104588 TTAGGTAAACAGAGAGAAGAAGG + Intronic
997629091 5:135353156-135353178 AAAGGGAAGCAGGGAGTTGCTGG + Intronic
997642008 5:135455497-135455519 CAAGCTAAGCAGAGAGGTGGGGG + Intergenic
999378759 5:151105308-151105330 TAGGAAGAGCAGAGAGATGCGGG + Intronic
1001154489 5:169261482-169261504 TAAGGAAAGGAGAGAGAGGGAGG - Intronic
1001179462 5:169505607-169505629 TAAGGTAGGCATAGAGGTGAGGG - Intergenic
1001740176 5:174046710-174046732 TAAGGCAAGCAGTGGGATTCTGG - Intronic
1002862796 6:1095027-1095049 TAGGGAAAGAAGAGAGAAGCTGG - Intergenic
1003220135 6:4153952-4153974 TAAGGGAAGCAGAGAAAAACAGG + Intergenic
1003359161 6:5407790-5407812 TCATGAAAGCAAAGAGATGCTGG - Intronic
1005211832 6:23474596-23474618 TCAGGTACGCAGGGAGATGATGG + Intergenic
1005377449 6:25198147-25198169 GAAGCTGAGCAGATAGATGCAGG + Intergenic
1005875736 6:30008459-30008481 TGGGGTAAGGAGAGAGATGGGGG + Intergenic
1006282884 6:33069442-33069464 AAAGGTGAGCAGAGTGAGGCTGG - Intronic
1006831838 6:36972805-36972827 CAAGGTAAGCAGAGATGAGCAGG + Intronic
1007287572 6:40758586-40758608 CAAGGTGAGCAGACAGGTGCTGG + Intergenic
1007392654 6:41559148-41559170 TAAGGTAAGTGGAGAGGGGCAGG - Intronic
1007800554 6:44388362-44388384 ACAGATAACCAGAGAGATGCGGG - Intronic
1008796037 6:55304295-55304317 TGAGGTCAACAGAGAGATACTGG - Intergenic
1009820697 6:68797433-68797455 GAAGGTAGAGAGAGAGATGCTGG + Intronic
1011412737 6:87082965-87082987 GAAGATAGGCAGAGAGATGGGGG - Intergenic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1014558694 6:122864196-122864218 TAAGAAAAGAAGAGAGAGGCTGG - Intergenic
1015478038 6:133675502-133675524 TAGGGAAAGCAGGGAGATGCCGG + Intergenic
1017598814 6:156059160-156059182 TGAGGTAAGAAGTGAGATGCAGG - Intergenic
1019522703 7:1467903-1467925 TAAGCTAAGCAGAGGCATCCGGG - Intergenic
1022323816 7:29311599-29311621 TATGCTCAGCATAGAGATGCTGG - Intronic
1022467248 7:30660348-30660370 TGAGGTCAGCAGAGTGGTGCAGG + Intronic
1022889426 7:34681454-34681476 CAAGGTAAGTAGAGGTATGCAGG + Intronic
1023100116 7:36709116-36709138 TAAGTTTAGCAGGGAGATCCTGG - Intronic
1023748352 7:43344606-43344628 AAAGGACAGCAGAGAGATGATGG - Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1025972661 7:66342611-66342633 GAAGCTAAGCAGATAGATGCTGG - Intronic
1027696215 7:81414073-81414095 TAAGGCAAATAGAGAAATGCAGG - Intergenic
1030557065 7:111039736-111039758 TAAGGGAGGAATAGAGATGCTGG - Intronic
1031323742 7:120365595-120365617 TAAGGTAAGGGCAGAGGTGCTGG + Intronic
1033095440 7:138426426-138426448 TAAAGTAAGGAGTGAGAAGCAGG + Intergenic
1033209854 7:139452813-139452835 AAAGGAAATCAGAGAAATGCAGG - Exonic
1036782546 8:11659469-11659491 GAAGGAAAACAGAGAGGTGCAGG - Intergenic
1038050673 8:23807572-23807594 TAAAGAAAGCAAAGAGAAGCAGG + Intergenic
1038169498 8:25116141-25116163 TAAGGAAAGCATAGAGCCGCTGG + Intergenic
1038588480 8:28812885-28812907 TAAGGAAAACAGAAAGATGATGG + Intronic
1039024497 8:33242858-33242880 TTAGGTTAGCAGAGGGAGGCTGG - Intergenic
1039392215 8:37190497-37190519 GAAGGTAACCAAAGAAATGCTGG + Intergenic
1039763066 8:40599140-40599162 TGAGGAAAACAGAGAGATGGAGG - Intronic
1040456600 8:47604493-47604515 TAGTGAAAGCAGAGAGACGCAGG + Intronic
1040744366 8:50622108-50622130 TAGGGTAAGCAGAGAGATTGGGG - Intronic
1044688364 8:94851020-94851042 TAAGGTTAACACAGAAATGCTGG + Intronic
1045026215 8:98089399-98089421 GAAGGAAAGAAGAAAGATGCAGG + Exonic
1046712289 8:117523511-117523533 GAAGGTAATCACAGAGATACTGG + Intronic
1047983814 8:130212113-130212135 AAAGGGAAGCAGAAAGTTGCTGG + Intronic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048266206 8:132989539-132989561 TGAGGTCAGGAGAGAGGTGCTGG - Intronic
1049886393 9:29583-29605 TCAGGTAGGCTGAGAGACGCAGG - Intergenic
1050022205 9:1295933-1295955 AAAGGGAAGCAGAGAAATGAGGG - Intergenic
1052394844 9:27926638-27926660 TAAGGTAAGAAGAGTGAAGCAGG + Intergenic
1052674111 9:31597137-31597159 TAAGTTATGGAGAGAGGTGCTGG - Intergenic
1055370072 9:75588863-75588885 AAAGGTAAGCTGACAGATGATGG + Intergenic
1055633305 9:78247247-78247269 TAAGGTAAGAAGACAGATGGGGG + Intronic
1055871547 9:80886555-80886577 CAAGGTAACCAGAGAGAACCTGG + Intergenic
1056892482 9:90508888-90508910 TAAGCTAAGGAGAGAAATGCAGG - Intergenic
1057368825 9:94450994-94451016 GAAGGAGAGCAGTGAGATGCTGG - Intronic
1057901494 9:98952405-98952427 TAAGATGAGTAGAGAGAAGCTGG - Intronic
1058839868 9:108895662-108895684 TATTTTAAGCAGAGAGATGAAGG + Intronic
1061116124 9:128613482-128613504 TGAGGTAAGCAAAGGGAGGCGGG + Exonic
1062187861 9:135228164-135228186 TGAGGAAGGCAGAGTGATGCAGG + Intergenic
1185664473 X:1754474-1754496 TAAGGTCTGCACAGAGCTGCAGG - Intergenic
1189080869 X:37971334-37971356 TAAGGTAAGAAGAGAAAGTCTGG + Intronic
1191792496 X:64985777-64985799 TATGGCAAGCAGAGGCATGCTGG + Intronic
1192877313 X:75245285-75245307 AAAGGAAAACAGATAGATGCTGG + Intergenic
1193582151 X:83278935-83278957 TATTGAGAGCAGAGAGATGCAGG + Intergenic
1194961778 X:100244422-100244444 TCAGATAAGCAGAGCTATGCAGG + Intergenic
1198998795 X:142607565-142607587 TAAGGAATGAAGAGAAATGCAGG + Intergenic