ID: 996939035

View in Genome Browser
Species Human (GRCh38)
Location 5:128981605-128981627
Sequence TAGAGTGAGCAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 550}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996939031_996939035 -3 Left 996939031 5:128981585-128981607 CCTAATGGCATGCGGCCAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG 0: 1
1: 0
2: 4
3: 57
4: 550
996939027_996939035 15 Left 996939027 5:128981567-128981589 CCAGTTATCTATCTAGCACCTAA 0: 1
1: 0
2: 0
3: 9
4: 121
Right 996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG 0: 1
1: 0
2: 4
3: 57
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996939035 Original CRISPR TAGAGTGAGCAGAAGGATGG AGG Intronic
901453967 1:9352841-9352863 AAGAGTGAGGAGGAGGCTGGGGG - Intronic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
905191205 1:36236477-36236499 TGGAGTGGGGAGAAGGAAGGAGG - Intronic
906283662 1:44571198-44571220 TAGAGAGAGCAGATGGAAGAGGG - Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910635784 1:89405728-89405750 GAGAGCGAGCAGAAGCAGGGTGG - Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911754937 1:101543106-101543128 TAGAGTGAGGAGAAGGAATAAGG + Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912720554 1:112016403-112016425 CAAAGTGAGCAGAGGGTTGGGGG - Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
915018959 1:152761623-152761645 AAGAGTGAGCAGAGGCTTGGAGG - Exonic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915412573 1:155714071-155714093 TAGAATGAGCAGAAGTATAGAGG + Intronic
915876444 1:159616219-159616241 AAGAGCGAGCAGAAGTAGGGTGG + Intergenic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917422221 1:174876008-174876030 AAGAGCGAGCACAAGGAAGGAGG - Intronic
917774917 1:178322583-178322605 TAGAATGACTAGAAGGATGGTGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
919230157 1:194763623-194763645 TAGAGTGAGCACTATTATGGTGG - Intergenic
919477820 1:198051293-198051315 TAGCCAGAGCAGAAGGAAGGTGG + Intergenic
919675112 1:200374397-200374419 TAGAGAGAGAAGAATGATGGTGG + Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921898359 1:220424308-220424330 TAGAGTGGGAAAGAGGATGGAGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922661392 1:227433408-227433430 TAGAGTGAGCAGAAAAATTCTGG - Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1062798049 10:358816-358838 TGGAGGGGGCAGAGGGATGGGGG + Intronic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1068318447 10:55378805-55378827 GAGAGTGAGAAAAAGGAGGGAGG - Intronic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1070959721 10:80490158-80490180 CAGAGTGAGGGGATGGATGGTGG + Intronic
1071058367 10:81538545-81538567 CTGAGTGAGCAAAATGATGGAGG - Intergenic
1072147873 10:92658820-92658842 TAGAGTCAGCAGACTGGTGGTGG + Intergenic
1072451187 10:95541021-95541043 TGGAGTGAGCAGGAGCCTGGGGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072744819 10:97932681-97932703 GTGAGTGAGAGGAAGGATGGAGG + Intronic
1072838018 10:98737557-98737579 TGGGGTGAGCAGAAGCAGGGTGG - Intronic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073978070 10:109122860-109122882 CAGATAGAGCAGAAGCATGGTGG + Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1075511782 10:123078331-123078353 TAGAGTCAGTTGCAGGATGGAGG + Intergenic
1076685385 10:132196321-132196343 TAGGACGAGCAGAAGGATGAGGG - Intronic
1078106534 11:8361470-8361492 GAGAGTGAGCAGGTGGGTGGGGG - Intergenic
1078657155 11:13252349-13252371 TAGCTTGAGCAAAAGCATGGAGG + Intergenic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079484571 11:20922068-20922090 TAGAGTGAACAAAAAGAAGGAGG - Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080648374 11:34203679-34203701 TAGAGGGGGCAGAAGAATGCAGG + Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080883399 11:36343561-36343583 TAGAGTGAGCAGAAATAATGTGG - Intronic
1081112825 11:39157960-39157982 TACAGTTGGCAGAAGGATTGTGG - Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081630576 11:44686840-44686862 GAGAGTGGGCAGAAAGGTGGTGG + Intergenic
1081732231 11:45379740-45379762 TGGAGTGTTCAGAAGGAAGGAGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1084490983 11:69478182-69478204 TAGAATGATCAGAAAAATGGAGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085252327 11:75152072-75152094 TAGAGTGGGGAGGAGGCTGGAGG + Intronic
1085464521 11:76714888-76714910 TAGAGGGCGCAGAAGGTGGGTGG - Intergenic
1086569518 11:88266026-88266048 TAGGGAGAGCAGAATGATTGTGG + Intergenic
1087048944 11:93867356-93867378 TAAAGGGAGCAGAAGAGTGGAGG + Intergenic
1087241803 11:95789472-95789494 GAGACTGAGGAGCAGGATGGCGG - Exonic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088779946 11:113124209-113124231 TAGACTGAGAAGGAGGAAGGAGG + Intronic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089877743 11:121741982-121742004 TAGATTCAGCAGAGGAATGGGGG - Intergenic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091058195 11:132438557-132438579 TAGGGTGGGCAGCAGGAAGGTGG + Intronic
1091058226 11:132438706-132438728 TAGGGTGTGCAGCAGGAAGGTGG + Intronic
1091074391 11:132601504-132601526 CAAGGTGAGGAGAAGGATGGAGG - Intronic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1094705373 12:32909407-32909429 AAGAGAGAGCAGAAGTGTGGAGG + Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1098038223 12:66328120-66328142 TAAAGAGGGCAGGAGGATGGTGG + Intronic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098637320 12:72800541-72800563 AAGAGTGAGTATAGGGATGGAGG - Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099135172 12:78888794-78888816 GACAGTGAGCAGGAGGAAGGAGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1102542804 12:113634817-113634839 GGGGGTGAGCAGAAGGGTGGGGG - Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104405042 12:128510131-128510153 TAAGGTGAGGAGAAGGATCGGGG + Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1106214371 13:27681667-27681689 TAGAGAGAGGAGAATGATGAGGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1107140209 13:36990691-36990713 TAGACTGAGCAGAAGTTGGGAGG - Intronic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109374303 13:61469835-61469857 TAGAGTGTGTTGAAGGGTGGTGG - Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110512871 13:76373634-76373656 GAAAGTGAGCAGAAGCATAGAGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1112254330 13:97815646-97815668 TAGAGTGGGGAGAAGGGAGGAGG + Intergenic
1113149985 13:107252477-107252499 GAGAGAGAGGAGAAGGAAGGAGG + Intronic
1114157111 14:20117475-20117497 AAGAGCGAGCTGTAGGATGGAGG + Exonic
1114447684 14:22802024-22802046 TACTGTGAGGAGGAGGATGGGGG - Intronic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115360005 14:32489929-32489951 GAGAGTCAGCAAAAGGGTGGTGG + Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116903238 14:50381254-50381276 TAGAGTGAGCACATGAATGTAGG + Intronic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117432728 14:55685503-55685525 TAGGGAGGGCAGAAGGATAGCGG - Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117874818 14:60241105-60241127 TGGAGAGAGCAGGAGAATGGAGG + Intergenic
1118264749 14:64284289-64284311 TAAAGTGAGCACAAGGCTGGGGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1119884889 14:78131856-78131878 TGAAGTTAGCAGGAGGATGGAGG - Intergenic
1119894380 14:78207311-78207333 TAGAGTGCGCAGGAAGAAGGTGG - Intergenic
1120407776 14:84110289-84110311 TAGAGAGAGGAGAATGATTGAGG + Intergenic
1120543056 14:85775270-85775292 TAAAGTGAGCTGAAGCAAGGTGG - Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1122451274 14:101809957-101809979 TAAAGCGGGCAGCAGGATGGTGG + Intronic
1122787593 14:104171143-104171165 TAGAGTCAGCAGAAAGCAGGGGG - Intronic
1123685509 15:22794404-22794426 TGGAGTGTGGAGATGGATGGTGG + Intronic
1125476911 15:40053994-40054016 AAGAGTGAGAAGAAAGTTGGGGG + Intergenic
1125748763 15:42014703-42014725 TAGAGTGACCAGAAGGACCTGGG - Intronic
1126853568 15:52815439-52815461 TGGAATCAGCAGAAGGAGGGTGG - Intergenic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG + Intronic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129458511 15:75688405-75688427 TAGAGTGGGGAGAAATATGGTGG + Exonic
1129594904 15:76955220-76955242 TAAATTTAGCAGAAGGAAGGTGG - Intergenic
1131224341 15:90611581-90611603 TGCGGTGACCAGAAGGATGGTGG - Intronic
1131868990 15:96742310-96742332 TATTGTGAGCAGAAGCATAGTGG + Intergenic
1132086189 15:98910192-98910214 TAGAGTGAGCAGGGGGCGGGAGG - Intronic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133107311 16:3520889-3520911 GAGAAAGAGCAGAAGCATGGGGG - Intronic
1134449395 16:14354215-14354237 TAGAGGGAGGAGGAGGAAGGGGG + Intergenic
1135664610 16:24325395-24325417 TAGAGTGGGCTAAAGGTTGGTGG - Intronic
1135699075 16:24615678-24615700 TAAAGTGAGCAGAGGGTTGCTGG + Intergenic
1137840628 16:51637477-51637499 GAGAGGGAGAAGAAGGAGGGGGG + Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139367611 16:66443171-66443193 TGGAGTGAGCAAGGGGATGGAGG + Intronic
1139684632 16:68593408-68593430 CAGAGAGGGCAGAAGGCTGGCGG + Intergenic
1140380130 16:74479378-74479400 TATAGTGACCAGAAAGATGCCGG + Intronic
1141048809 16:80742420-80742442 TTGAGTGGGTAGAAGGGTGGAGG + Intronic
1142478624 17:204589-204611 GTGAGTGAGGAGATGGATGGAGG - Intergenic
1142965939 17:3581369-3581391 GGGAGGGAGCAGAAGGGTGGTGG - Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143779588 17:9222229-9222251 TGGAGTGAGGAGGAGGACGGAGG - Intronic
1146296098 17:31651880-31651902 TGGAGCGGGCAGGAGGATGGGGG + Intergenic
1148234143 17:45956191-45956213 AGGAATGAGCTGAAGGATGGGGG + Intronic
1148714178 17:49704027-49704049 TAGAGGGATCAAAAGGATGAGGG + Intronic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149386862 17:56151002-56151024 CAGAGTGAGAGGCAGGATGGAGG + Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1152032353 17:77851776-77851798 GACAGTGGGCAGGAGGATGGCGG - Intergenic
1152073323 17:78144796-78144818 GGGAGTGGCCAGAAGGATGGTGG - Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153945044 18:10010565-10010587 GAGAATGAGCAGAATGATGCTGG - Intergenic
1155517383 18:26637211-26637233 TAGAGTCAGGAGGAGGAAGGAGG - Intronic
1155546394 18:26920210-26920232 AAGAGTGGTCAGAAAGATGGTGG - Intronic
1155577490 18:27263914-27263936 TGGGGAGTGCAGAAGGATGGTGG - Intergenic
1156084482 18:33382533-33382555 GACAGTGAGCAGAAGCAGGGTGG + Intronic
1156109257 18:33703670-33703692 AAAAGTGAGGAGAGGGATGGGGG - Intronic
1156332214 18:36132957-36132979 GAGAGTGAGCAGAAGCAGGTGGG + Intronic
1157068030 18:44374709-44374731 GAAAGTGAGCAGAAGCAGGGTGG + Intergenic
1157178952 18:45478279-45478301 TAGGGCGAGCAGAAGCAGGGTGG - Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1162300403 19:9841821-9841843 AAGAGTGAGCAGGAGGGTGCAGG + Intronic
1162501992 19:11059465-11059487 GAGATTGTGCAGAAGGAGGGAGG + Intronic
1163527480 19:17830461-17830483 TGGAGGGAGAAGAAGGCTGGGGG + Intronic
1163627993 19:18401922-18401944 TATAAGGAGCAGAGGGATGGAGG + Intergenic
1163731160 19:18950087-18950109 AAAAGTCAGCAGAAGGCTGGAGG + Intergenic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164133225 19:22384910-22384932 GAGAGTGAGCCGAAGCAGGGCGG - Intergenic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1164165587 19:22671846-22671868 GAGAGTGAGCCGAAGCAGGGCGG + Intergenic
1165289732 19:34873641-34873663 AAGAGTGAGCAGAAAGTTGCTGG + Intergenic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1167504434 19:49863644-49863666 TGGAGTGAGGAAAAGGAGGGGGG + Intronic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
925030174 2:644263-644285 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925030180 2:644340-644362 TAGAGTGAATGAAAGGATGGAGG + Intergenic
925484581 2:4313653-4313675 TAGGGGGAGCAGAAGCAGGGTGG - Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926122676 2:10253489-10253511 TGGCGTGAGCAAAAGGCTGGAGG - Intergenic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
930196663 2:48517409-48517431 TTGACTGAGCAGGAGGATTGAGG + Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931183094 2:59923315-59923337 TAAAGTGAGCATGTGGATGGTGG - Intergenic
931461459 2:62453823-62453845 TAGACTGAGCTAAAGGGTGGGGG + Intergenic
931541503 2:63334589-63334611 TAGAGTGAGTAGTAGGAGGCTGG + Intronic
931952714 2:67383076-67383098 AAGAATGAGATGAAGGATGGAGG - Intergenic
932418318 2:71586820-71586842 TAGGGTGAGCATAGGGAGGGAGG - Intronic
932581014 2:72992765-72992787 TGTAGAGAGCAGATGGATGGGGG - Intronic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
933317794 2:80736558-80736580 GAGAGTGAGCAGAAGTACGGTGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933966663 2:87435533-87435555 GAGAGTGAGCAGCATGAGGGTGG - Intergenic
934555014 2:95282479-95282501 GACAGTGAGCAGGAGGATGAGGG + Intronic
935210227 2:100933301-100933323 TAGAGAGAGGAGAAGGACAGAGG + Intronic
936015852 2:108958555-108958577 TAGAGAGGGCAGAAGGACGGTGG + Intronic
936409083 2:112238091-112238113 TAGAGGGAGCTGGAGGATGGAGG - Intronic
936526575 2:113245600-113245622 TAGAGGGAGGGGAAGGGTGGAGG - Intronic
936684776 2:114815041-114815063 GAGAGGGAGCAGAAGGGTGGAGG - Intronic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
936941130 2:117885554-117885576 TAGAATCAGAAGAAGGGTGGTGG - Intergenic
936964533 2:118114502-118114524 AAGAGTGAGTAGCTGGATGGAGG - Intergenic
937479209 2:122241579-122241601 AAGGGTGAGAAGAAGGAAGGAGG + Intergenic
937552318 2:123108922-123108944 GAGAGGGAGGAGCAGGATGGTGG - Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937612209 2:123875759-123875781 TAGAGTGAGCAGAGGGATCTGGG + Intergenic
937907488 2:127059298-127059320 GAGAGAGAGCAGGAGGGTGGGGG + Intronic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938403807 2:131016034-131016056 TAGAGTGAGAAGCAAGAAGGAGG - Intronic
939034066 2:137110038-137110060 GGGAGTGAGCATAAGGATGTTGG - Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940479707 2:154212712-154212734 TAGAAGGAGAAGAAGGATGGGGG - Intronic
940827823 2:158433650-158433672 AAGTGTGAGCTGAAGCATGGTGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941675199 2:168336885-168336907 TGGAGTGAGGAGGAGGAGGGAGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
946547193 2:220757048-220757070 TGGTGTGAGCAGAAGAATGGGGG - Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947951082 2:234147845-234147867 TAGAGTGATCAGCAAGAGGGTGG + Intergenic
948478806 2:238238131-238238153 CAGAGTGAGCAGTGTGATGGTGG - Intergenic
1168954433 20:1824925-1824947 AAGAGTGAGCAGCTGGCTGGAGG + Intergenic
1170933037 20:20786037-20786059 GAGAGAGAGAAGAAGGAGGGGGG - Intergenic
1171782703 20:29435510-29435532 TAGAGATGGCAGAAGGATGAGGG + Intergenic
1172230850 20:33334499-33334521 GAGGGTGGGCAGATGGATGGTGG + Intergenic
1172817250 20:37697383-37697405 TGAAGGGAGCAGAATGATGGAGG + Intronic
1173045314 20:39504108-39504130 TAGTGTGAGTAGGAGGAGGGAGG + Intergenic
1173295461 20:41751607-41751629 TGCAGTGAACAGTAGGATGGAGG - Intergenic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173520950 20:43700112-43700134 TGGAATGAGCAAAAGGATGTGGG - Intronic
1173596485 20:44261910-44261932 TAGTATGAGCAGAAGCCTGGAGG + Intronic
1174207041 20:48847805-48847827 TATAGAAATCAGAAGGATGGGGG - Intergenic
1174224117 20:48982968-48982990 TAGGGTGAGCTGAAGCAGGGCGG - Intronic
1175082566 20:56433329-56433351 TAGAGAGAACAGCATGATGGAGG + Intronic
1176030171 20:63007851-63007873 TAGAGTGTGCTGAGGGATAGTGG + Intergenic
1176312371 21:5159095-5159117 AGGAGTGTGCAGAATGATGGGGG + Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1177804890 21:25865482-25865504 GAGAGAGAGAAGAAGGCTGGAGG - Intergenic
1178342082 21:31794220-31794242 TTGAGTGGAGAGAAGGATGGCGG + Intergenic
1179003636 21:37487985-37488007 AAGAGTGAGGAGAAGGCAGGAGG - Intronic
1179667487 21:42922785-42922807 TGAAGGGAGCAGAAGGGTGGAGG + Intergenic
1179844677 21:44102935-44102957 AGGAGTGTGCAGAATGATGGGGG - Exonic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182161392 22:28125502-28125524 TACAGTGAGCTGATGGCTGGGGG - Intronic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
949324087 3:2844026-2844048 TATATGGAACAGAAGGATGGGGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949754481 3:7393062-7393084 TAGAGTGAGCACAAAGCTGTGGG + Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952583322 3:34861503-34861525 TACAGTTAACAGAATGATGGCGG - Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953456836 3:43049031-43049053 AAGAGTCAGGGGAAGGATGGAGG + Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953856770 3:46505347-46505369 TAGAGGGAGCACTAGGATGCAGG - Intergenic
954187521 3:48929713-48929735 TAGTGTGACAAGAATGATGGAGG - Intronic
954974789 3:54683193-54683215 TTGAGGCTGCAGAAGGATGGTGG - Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962604954 3:137025371-137025393 TGGGTTGTGCAGAAGGATGGTGG + Intergenic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
962874008 3:139522058-139522080 TAGAGAGAGCAGAAGTCTGTTGG + Intronic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963112747 3:141700602-141700624 TGCAGGGAGCAGAAGGGTGGTGG + Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
965001992 3:162966163-162966185 GACAGTGAGCAGAAGCAGGGTGG + Intergenic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
967527393 3:190510589-190510611 TAGAGGAAGCAGAAGGTTTGTGG + Intergenic
967612841 3:191528240-191528262 TAGATAGAACAGAAAGATGGAGG + Intergenic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970317950 4:14847227-14847249 AGGAGTGAGCAGAAAGTTGGAGG + Intergenic
970573992 4:17409671-17409693 AATGGTGAGCAGAGGGATGGAGG - Intergenic
970904245 4:21196930-21196952 TTGAGTGGGAAGAAGGATGAGGG - Intronic
971566136 4:28143969-28143991 GAGAGAGAGCAGAAGCCTGGGGG - Intergenic
974476309 4:62386728-62386750 TCAAATAAGCAGAAGGATGGAGG - Intergenic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
975227438 4:71891269-71891291 TAGAGTGAGCAGAAACAGGGTGG + Intergenic
975449274 4:74505471-74505493 AAGAGTGAGCTGAAGCAGGGTGG + Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
976205149 4:82617321-82617343 TGCAGAGAGCAGAAGTATGGAGG + Intergenic
977398258 4:96498665-96498687 TAGAAAGAGCAGAGGGAAGGAGG + Intergenic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978347581 4:107788154-107788176 TGTAGTGAGCAGAGGGTTGGGGG + Intergenic
978601506 4:110432460-110432482 GAGGGTGAGCCGAAGCATGGTGG - Intronic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979561326 4:122105194-122105216 CCTAGTGAGGAGAAGGATGGAGG + Intergenic
979689620 4:123546857-123546879 TCGAGTGAGCAATAGGATGAAGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
982502914 4:156180590-156180612 TAGAGAGATCAGAAAGATAGGGG + Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984766605 4:183404907-183404929 TAGAGTGAGTAGGAGGGAGGAGG + Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
986266634 5:6196706-6196728 TAGAGGCAGCAAGAGGATGGCGG + Intergenic
987114971 5:14718925-14718947 GAGACAGAGCAGAAGGATGAAGG + Intronic
987523882 5:19023075-19023097 GAGATTGAGAAGAAGGAGGGAGG - Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
990470654 5:56112197-56112219 TTCAATGAGCAGAAGGATGGAGG + Intronic
990644819 5:57832233-57832255 GAGAGTGAGCACATGGCTGGCGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992667492 5:79025427-79025449 TAGAGTGCGCAGAAGCAAGTGGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993145327 5:84086448-84086470 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994646743 5:102479500-102479522 AAGAGTGAGCGGAAAGATAGGGG - Intronic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996924109 5:128802482-128802504 TAGTGCTAGCAAAAGGATGGAGG + Intronic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
997420212 5:133760729-133760751 TAGAGTGAGAAAAAGGAAGAGGG + Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998927566 5:147142833-147142855 GAGAGGGAGCAGAAGCAGGGTGG - Intergenic
1000091481 5:157933062-157933084 TAGAGTGGGCAGCAGGAGGCTGG + Intergenic
1000884122 5:166731583-166731605 TAGACTGAGAAGAAAGTTGGAGG + Intergenic
1001210172 5:169803677-169803699 TAGGGTGTGGAGTAGGATGGTGG + Intronic
1001586140 5:172834766-172834788 TAGAGGGAGGAGAGGGATGCTGG - Intronic
1002190576 5:177475287-177475309 TTGAGTGTGCAGGAGGCTGGGGG - Intergenic
1003079025 6:3006121-3006143 TAGATCGAGCAGAAGGCTGGGGG - Intronic
1003684340 6:8286140-8286162 TTGAGTGAACAGAAGAATAGAGG - Intergenic
1003759693 6:9162778-9162800 AAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1004082308 6:12406817-12406839 TAGAGGGTGCAGAAAGATGTTGG - Intergenic
1004173202 6:13315248-13315270 TAGGCTGAGCAGGAGGAGGGAGG - Intronic
1004249951 6:14015616-14015638 GAGAGAGAGCAGAGGAATGGAGG - Intergenic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1004715577 6:18213630-18213652 CAAAGTGAGCAGAAGAAAGGTGG - Intronic
1005255478 6:23998289-23998311 TAAAGTGAGCAGTAGCTTGGTGG - Intergenic
1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG + Intronic
1006074145 6:31519098-31519120 TACTGCGAGCAGATGGATGGAGG + Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008190585 6:48452111-48452133 TAGTGTGTGAAGAATGATGGTGG - Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009633815 6:66236718-66236740 TAGAGTGAGTATAAGGAAGAGGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010101425 6:72112531-72112553 TACAGTGAGCAGAAGGTAGCAGG - Intronic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1011120005 6:83942319-83942341 GAGGGCGAGCAGAAGCATGGTGG + Intronic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1011577977 6:88825851-88825873 CAGAGTGAGGAGAAGGATAGTGG - Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1013619114 6:111872333-111872355 TGGAGGGAGCAGAGGGGTGGGGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015433307 6:133155389-133155411 GAGGGTGAGCAGAAGCATGTTGG - Intergenic
1015524498 6:134162826-134162848 AAGAGTGAGCAGAATGGTGTTGG + Intergenic
1015693687 6:135956148-135956170 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1015693697 6:135956226-135956248 TAGAGTGGGCAGAAAGATAAAGG + Intronic
1016125371 6:140395763-140395785 AACAGTGAGCAGCAGGAGGGAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017586940 6:155936878-155936900 TAGAGAGAGAAGGAGGAGGGAGG + Intergenic
1018113927 6:160564673-160564695 GAGAGTGAGCCGAAGCAAGGCGG + Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018974244 6:168552833-168552855 TGGAGTGAGCAACAGGCTGGTGG - Intronic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019896046 7:3984187-3984209 GAGAGGGGGCAGAGGGATGGAGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1020926760 7:14337606-14337628 TAAAGTGAGAAGATGGTTGGTGG - Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022138042 7:27467487-27467509 TAGAGTGTGAAGAAGCATGTTGG - Intergenic
1022456807 7:30564832-30564854 TAGAGACACCAGAAGGCTGGTGG + Intergenic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1026427371 7:70310033-70310055 TAGAGTGAGTAGAAGGTTAATGG + Intronic
1027837196 7:83259680-83259702 AAGAATGTGCAGAAGGATGCAGG - Intergenic
1028718350 7:94000487-94000509 TACAGTAAGGAGAATGATGGAGG + Intronic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1029290463 7:99498733-99498755 GAGAGTGCGCAGAAGGATTCCGG - Exonic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1030958774 7:115889013-115889035 GAGAGTGAGCCGAAGCAGGGTGG + Intergenic
1032086170 7:128884967-128884989 TGGAGTGTGCACAAGGACGGAGG + Intronic
1032526883 7:132584877-132584899 GAGAGTGAGCAGAGGACTGGCGG - Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1033227114 7:139571097-139571119 TCTAGTGGGCAGAAGGTTGGAGG - Exonic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1033618761 7:143042715-143042737 AATTGTGAGCAGAAGGAGGGAGG - Intergenic
1033663851 7:143422962-143422984 TGCAGTGTGCAGAAGGATGCAGG + Intergenic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1034132985 7:148738195-148738217 TAAAGTGAGCAGCAGGATGACGG - Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1034892820 7:154855602-154855624 TAGAGTGGGCAGAGGGTGGGTGG - Intronic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1039038443 8:33384485-33384507 TAGAGTAGGCAGAGGTATGGGGG - Intronic
1039187164 8:34930404-34930426 GAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1041280112 8:56200054-56200076 AGGGGTGAGCAGAATGATGGTGG - Intronic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041481882 8:58331599-58331621 GATAGTGAGCAGAAGTAGGGTGG + Intergenic
1041732951 8:61081246-61081268 AAGAGAGAGCAGAAGGAATGAGG + Intronic
1041814650 8:61955904-61955926 TAGAGAGAGCAGAAGAAAAGAGG + Intergenic
1042118534 8:65458872-65458894 TAGAGTGAGCATGTGGGTGGGGG - Intergenic
1042622799 8:70724671-70724693 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1047050643 8:121107970-121107992 TACAGAGATCAGAAGGAAGGGGG - Intergenic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1049739881 8:144233530-144233552 TAGAGAGAGAAGGTGGATGGTGG - Intronic
1049760386 8:144329495-144329517 TAGAGTGGGTGGAAGGATGGAGG - Intergenic
1049783334 8:144438946-144438968 TCAAGTGGGCAGAGGGATGGTGG - Intronic
1049872452 8:144991093-144991115 GAGAGGGAGCAGAAGCAGGGAGG - Intergenic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1050963213 9:11764895-11764917 AATAGAGAGCAGAAGGATGGAGG + Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052020974 9:23524886-23524908 TAGAGAGAGGAGAAGGGAGGTGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052381107 9:27772012-27772034 TAGAGACAGCTGGAGGATGGGGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1053885925 9:42645209-42645231 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054224943 9:62452658-62452680 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054354977 9:64051808-64051830 TAGAGTGAGAACAGAGATGGCGG + Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055511035 9:76995791-76995813 TGGAAGGAGCAGAAGGAAGGGGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055702349 9:78959100-78959122 TTGAATGAGCAGAAGCATCGTGG + Intergenic
1055739556 9:79371608-79371630 GAGAGTGATTAGCAGGATGGTGG - Intergenic
1055766173 9:79666106-79666128 TAGAGTGAGAAGCAGGAATGAGG + Intronic
1055934132 9:81589298-81589320 GAGAGAGGGCAGAGGGATGGGGG - Intronic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1057369729 9:94459544-94459566 GAGGATGAGCAGAATGATGGCGG - Exonic
1057870970 9:98717082-98717104 TAGAATGAGCAAAGGTATGGAGG - Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061942579 9:133891493-133891515 CAGATAGAGGAGAAGGATGGAGG + Intronic
1062180446 9:135188590-135188612 AGGCGTGTGCAGAAGGATGGTGG - Intergenic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1185569716 X:1124194-1124216 CGGAGTGAGCAGAAGGACAGAGG + Intergenic
1185856246 X:3538902-3538924 TAGAGTGAGCAGCAGAATCAGGG + Intergenic
1185895406 X:3854160-3854182 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185900523 X:3892584-3892606 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1185905639 X:3931015-3931037 AAGAGGGAGAAGAAGGAAGGAGG - Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189093217 X:38109713-38109735 TAGAACAAGCAGAAGGCTGGAGG + Intronic
1190008025 X:46758781-46758803 GAGCGTGAGCAGCAGGATGAAGG + Exonic
1190912772 X:54787927-54787949 TGGCTTGAGCACAAGGATGGCGG - Intronic
1190918185 X:54825449-54825471 TGGCTTGAGCACAAGGATGGCGG + Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1192712927 X:73610363-73610385 GAGAGCGAGCAGAAGCACGGTGG - Intronic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192916126 X:75652741-75652763 GAGAGTGAGTAGAAGCAGGGTGG - Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1194033422 X:88842850-88842872 TAGAGGTTGCAGAAGGATGAAGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194737052 X:97525044-97525066 TAGAGTGAGTAGCTGGATGGTGG - Intronic
1195434774 X:104829425-104829447 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196229380 X:113203229-113203251 TAGAGTGAGGAAAAGTAGGGTGG - Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196663549 X:118293640-118293662 TAGGGGTTGCAGAAGGATGGAGG + Intergenic
1196729196 X:118924065-118924087 GATAGAGAGTAGAAGGATGGTGG - Intergenic
1196858437 X:120005312-120005334 TAGAAAGAGCAGAGGGAGGGGGG - Intergenic
1196918180 X:120560839-120560861 AGGAGTGAGCAGAACGAGGGGGG + Intronic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197767745 X:130069986-130070008 GAGAGTGAGGGGATGGATGGCGG + Intronic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198010367 X:132546375-132546397 TACTGTGAGCAGAAAGATAGAGG - Intergenic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198801370 X:140451238-140451260 AAGAGTGAGCACAAGAAAGGAGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1198995443 X:142568604-142568626 TGGAGTGAGCAGAAGCATGGTGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic