ID: 996940484

View in Genome Browser
Species Human (GRCh38)
Location 5:128999610-128999632
Sequence GGGTGTAAAAAGTTGGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996940484 Original CRISPR GGGTGTAAAAAGTTGGACTT TGG (reversed) Intronic
904417471 1:30372173-30372195 GGGAGGAAGAAGATGGACTTAGG - Intergenic
908454899 1:64294098-64294120 GGGCTTAAAAAATTGGCCTTCGG + Intergenic
909160411 1:72141153-72141175 GTGTGTAATATGGTGGACTTAGG + Intronic
910497082 1:87842494-87842516 GGGTGCAAAAAGGTAGGCTTAGG + Intergenic
917077927 1:171225359-171225381 TGGTGAAAAAAATTGGACCTAGG - Intergenic
921621729 1:217332980-217333002 GGGTTTAAAGAGTTGTATTTAGG + Intergenic
922025416 1:221743943-221743965 TGGTGTGAAAAGCTGGACTGGGG - Intergenic
922432648 1:225571076-225571098 GGGATTCAAAAGTTGCACTTGGG + Intronic
922494498 1:226045768-226045790 GGATTTAAAAAATTGTACTTGGG - Intergenic
1063102068 10:2958930-2958952 GGGTGAAAAAAGTTGTTCTGGGG + Intergenic
1067431372 10:46248172-46248194 AGGTGTAAAAGGCTGGACTGTGG + Intergenic
1072826523 10:98612123-98612145 GGCTGGAAAAAGATGGTCTTTGG - Intronic
1074949389 10:118314942-118314964 GGGTGTAAAATGTTCTAATTTGG + Intronic
1078571483 11:12461777-12461799 GGGTGGAAACTGTAGGACTTGGG + Intronic
1080147622 11:29006115-29006137 GGGTGAGAAAAGTTGGAGTTTGG + Intergenic
1084288384 11:68146419-68146441 GGGTGTGATGAGTTGGTCTTGGG + Intergenic
1085631887 11:78125330-78125352 AGGTGCAAAAAGTGAGACTTAGG - Intronic
1088233295 11:107696199-107696221 TAGTGGAAAAAGATGGACTTTGG - Intergenic
1092343246 12:7694136-7694158 GGGTGTAAAAGGTGAGACTGGGG + Intronic
1092438733 12:8477224-8477246 GGGTGAACAAAGTGGGATTTAGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093118544 12:15240467-15240489 GGGAAAAAAAAGTTGAACTTTGG - Intronic
1093917934 12:24826438-24826460 GGTTGTAAACATGTGGACTTAGG + Intronic
1094373353 12:29763065-29763087 GGGTGTAGCAAGTTGGAATGAGG + Intronic
1096038338 12:48492492-48492514 GGCTGTAAAAAGGTGGATTTAGG + Intronic
1096790713 12:54043061-54043083 GGGTGTGCAATGTGGGACTTGGG + Intronic
1100529597 12:95451444-95451466 GGGTGTCCAAAGTTTAACTTGGG + Intergenic
1103435672 12:120923589-120923611 GGGCGTTAAAAGTTTGACTTAGG - Intergenic
1104241889 12:126998034-126998056 GGGGCTAAAAATTTAGACTTAGG - Intergenic
1106248437 13:27967154-27967176 GGCTGTAGAAAGTGGGTCTTTGG + Intronic
1107704496 13:43086923-43086945 GGGTGTGAAAGAATGGACTTCGG + Intronic
1109493949 13:63143648-63143670 CGGTGTAACCAGTTGGACTTGGG - Intergenic
1111877616 13:93916496-93916518 GGGGTTAAAATGTTGGAGTTTGG - Intronic
1113981360 13:114279822-114279844 GGGTGTTAAAAAATTGACTTGGG + Intergenic
1116107463 14:40527988-40528010 GAGTGGAAATAGTTGGAGTTTGG - Intergenic
1116639743 14:47446084-47446106 GTGAGTAAAAAGTTGTACATAGG - Intronic
1117637372 14:57758720-57758742 TGTTGTAAATTGTTGGACTTTGG + Intronic
1121155909 14:91683738-91683760 GGGTTTAAAAAGGGGCACTTGGG - Intronic
1121559168 14:94861823-94861845 AGGTTTAAACAGTTGGTCTTTGG - Intergenic
1121765588 14:96482782-96482804 GGGTAGGAAAATTTGGACTTGGG - Intronic
1126679981 15:51193100-51193122 GGGTGGAAACAGTGGGGCTTGGG + Intergenic
1129109909 15:73331226-73331248 GGGTGAGAGAAGTTGAACTTGGG - Intronic
1129904579 15:79177333-79177355 GGGTGACAAAAGTTGGAAATGGG + Intergenic
1131183355 15:90255459-90255481 GGGTGTTAGAAGGTGGACTGTGG + Intronic
1136027395 16:27477867-27477889 GGGAGTCAAAAGTTATACTTGGG + Intronic
1137610443 16:49814014-49814036 AGGAGTAAAAAGTGGGAGTTCGG - Intronic
1138938368 16:61758922-61758944 GGGTGTGAAAAATCTGACTTTGG + Intronic
1139384544 16:66557105-66557127 GTGTGTAAAAAATGGTACTTTGG + Intronic
1139733016 16:68963416-68963438 GGGTGTAAAAAGTAGGGCAAGGG - Intronic
1140221836 16:73049128-73049150 GAATGGAAAAAGGTGGACTTGGG - Intronic
1144057069 17:11552852-11552874 GGGTCTAAAAAGTTAGAACTGGG + Intronic
1147515332 17:41111873-41111895 GCGAGTAAACAGTTGAACTTTGG - Intergenic
1148098845 17:45074745-45074767 AAGTGAAACAAGTTGGACTTTGG + Intronic
1149253184 17:54793936-54793958 GGGTGGAAAAAGTTGGATCTAGG - Intergenic
1151022916 17:70639922-70639944 GGGTGTAAAAAGACCAACTTGGG - Intergenic
1154984706 18:21538149-21538171 GGGAATCAAAAGTTGTACTTGGG + Intronic
1155924866 18:31644821-31644843 GGACTTGAAAAGTTGGACTTTGG - Intronic
1157272187 18:46284340-46284362 GGAAGTAAGAACTTGGACTTTGG + Intergenic
1159086073 18:63793434-63793456 TTGGGTAAAAAGTTGAACTTTGG - Intronic
1159359006 18:67376505-67376527 GGGAGTAAAAATTTGGGATTTGG - Intergenic
1159601416 18:70431736-70431758 GTGTGAAAAAAGTTGAACTCAGG + Intergenic
1167261945 19:48463625-48463647 GGGTGCAGAATGTTGGACCTAGG + Intronic
1167503320 19:49859103-49859125 AGGTGGAGAAGGTTGGACTTTGG + Intronic
1168366597 19:55793266-55793288 GGGGTTAAAAAGTTGGAAATAGG + Intronic
925136802 2:1528511-1528533 GGTTGTACACAGTTGGAATTTGG - Intronic
927007206 2:18863191-18863213 GAGTTTACAAAGTTGTACTTAGG - Intergenic
928643490 2:33325839-33325861 AGGTGTAGAAAGGTGGATTTTGG + Intronic
929066695 2:37982989-37983011 GAGAGTTAAAAGTAGGACTTCGG - Intronic
931820609 2:65947776-65947798 CCAGGTAAAAAGTTGGACTTTGG - Intergenic
936639021 2:114291724-114291746 GCGTGTTAAAAGTTGGGGTTGGG + Intergenic
936725972 2:115316493-115316515 AGGTGTAAAAATTTGGACAAGGG + Intronic
936856395 2:116963145-116963167 GGGTATAAATAGTTGGATTACGG + Intergenic
942490476 2:176484749-176484771 GGGTTTCAAAAGTTGGAATGGGG + Intergenic
943198308 2:184784882-184784904 TGGTGGATAAACTTGGACTTGGG + Intronic
944433095 2:199657868-199657890 GGGTGGAAAAAGTTGGAGTTGGG + Intergenic
946988052 2:225296312-225296334 AGTTGTAAAAAGTATGACTTGGG + Intergenic
947184342 2:227441711-227441733 GGGTGCAAAAAGTTAGCCTTCGG + Intergenic
947708926 2:232298990-232299012 GGGAGTCAAAGGTTTGACTTTGG - Intronic
1170394210 20:15908481-15908503 GGGTGTAAAAAGTTTAATATGGG - Intronic
1171949189 20:31405816-31405838 GGGTGTAAAGAGAGAGACTTGGG - Intronic
1173037055 20:39422321-39422343 GGGAACAAGAAGTTGGACTTAGG + Intergenic
1174317017 20:49711544-49711566 GGGTGTGAAAAGATGGGATTTGG - Intronic
1174386117 20:50189568-50189590 GGGTGAAAAAAGTTGAACCTCGG + Intergenic
1175154362 20:56959714-56959736 TGGTGTAAAAAGTGAGAGTTAGG - Intergenic
1175553031 20:59829134-59829156 GGGTGTGAAAAGGTCGGCTTTGG + Intronic
1177020183 21:15845589-15845611 GGGGGAAAAAAATTGCACTTAGG - Intronic
1177749586 21:25263454-25263476 TGGTTTATAAAGTTGGAATTTGG + Intergenic
1178710525 21:34912629-34912651 GGGTGTAAAAAGAGGGACCCAGG - Intronic
1179284221 21:39962766-39962788 GGGTGTAATAAGTAGGAGATGGG - Intergenic
1181718516 22:24754290-24754312 GGGTCTAAAAATTGGTACTTAGG + Intronic
1182438451 22:30346448-30346470 GGGTTCAGAAAGTTGAACTTGGG + Exonic
952864815 3:37847613-37847635 GGGAGTAAAAAGTTAATCTTTGG + Intergenic
952909642 3:38171863-38171885 AGCTGTAAAAATTTGGGCTTTGG + Intronic
953948128 3:47165916-47165938 GTGTGTAAAAAAATGGCCTTGGG - Intergenic
964372477 3:156015332-156015354 GTGTGTAAAAAGTAGGCTTTTGG - Intergenic
967630952 3:191742484-191742506 AGGTGTAAAAATTTGGTCCTAGG + Intergenic
971614478 4:28769981-28770003 GGGTTTAAAAAGTAGCTCTTGGG + Intergenic
974106831 4:57479317-57479339 GGGAAAAAAAACTTGGACTTGGG + Intergenic
976233235 4:82867931-82867953 GAGTTTAAAAAGTTGGCCCTAGG - Intronic
978554812 4:109968862-109968884 GGGTGTTAAGAGCTTGACTTTGG - Intronic
984379223 4:178968958-178968980 GGGAGTCAAAAGTTACACTTGGG - Intergenic
992049968 5:72932871-72932893 GGGTGTTCAAAGTTTAACTTGGG - Intergenic
993423897 5:87738201-87738223 TTGTGTAAAATATTGGACTTAGG - Intergenic
995133517 5:108656098-108656120 GGGGGTAAAAAGTGTGTCTTTGG + Intergenic
996940484 5:128999610-128999632 GGGTGTAAAAAGTTGGACTTTGG - Intronic
1001562719 5:172679846-172679868 GGGTGTATAAAGGGGGACTAAGG - Intronic
1004610941 6:17238804-17238826 GGTTGTAAAGTGTTGGCCTTGGG - Intergenic
1005999248 6:30952677-30952699 GGAGGTAAAAAGCTGGAATTGGG + Intronic
1006857863 6:37148208-37148230 GGGGGTAAAATGTTGGAGGTGGG + Intergenic
1007887475 6:45247311-45247333 GCATGTAAAAACTTGGCCTTTGG + Intronic
1011603859 6:89082844-89082866 AGTTGTAGAAAGGTGGACTTGGG + Intronic
1012788768 6:103664836-103664858 GGATGAAAACAGTTGGATTTTGG - Intergenic
1012887568 6:104862595-104862617 GGTTATACACAGTTGGACTTGGG - Intergenic
1014508252 6:122285955-122285977 GGGTGTGAAAAGTTGTAATCTGG - Intergenic
1016639404 6:146331892-146331914 GGTTGAAAAAAATTGGCCTTCGG + Intronic
1024043310 7:45571457-45571479 GGGTGTCAAAAGTTGAATTGTGG - Intergenic
1024135204 7:46399730-46399752 GGGATTAAAAAGTGGGTCTTCGG + Intergenic
1024636243 7:51292771-51292793 GGCTGCAAAGAGTTGGGCTTGGG - Intronic
1024638169 7:51307854-51307876 GGATTTAAAAAGTGGGAATTGGG - Intronic
1027515565 7:79137761-79137783 GGGTGTAAAAATCTGTATTTGGG - Intronic
1033228975 7:139582128-139582150 GGGTGGAAAAAGATGGTTTTTGG + Intronic
1039220875 8:35329237-35329259 GGCAGTAAAAAATAGGACTTGGG - Intronic
1039337524 8:36608428-36608450 GGGTATAAAAAGTGGGAAGTTGG - Intergenic
1039999106 8:42561579-42561601 GGGTGTCAAAAATTTGACTTGGG + Intergenic
1041102100 8:54406743-54406765 TGATGTTAAAAGTTGGCCTTTGG + Intergenic
1042993459 8:74666897-74666919 GGCTGTAATCAGTTGGAGTTTGG + Intronic
1048766025 8:137845621-137845643 GGTTGAAAAAACTTGGACTAAGG + Intergenic
1053607462 9:39675486-39675508 GGGTGTAAAAAGTGGGAGGTGGG - Intergenic
1053865311 9:42431844-42431866 GGGGGTAAAAAGTGGGAGGTGGG - Intergenic
1054246073 9:62666923-62666945 GGGTGTAAAAAGTGGGAGGTGGG + Intergenic
1054560195 9:66701456-66701478 GGGTGTAAAAAGTGGGAGGTGGG + Intergenic
1056139126 9:83657473-83657495 GGTGGTAAGAAGTTGGATTTGGG - Intergenic
1056871041 9:90278919-90278941 GGGGGTAGAAAGGAGGACTTGGG + Intergenic
1193598616 X:83480235-83480257 GAGTGAAAAAACCTGGACTTGGG - Intergenic
1194328611 X:92553515-92553537 GAGTGAAAAAAGTTGGTTTTTGG - Intronic
1196408345 X:115389730-115389752 GGGAGTCAAAAGTTATACTTGGG - Intergenic
1198039010 X:132830839-132830861 GGGTGTAAAAACTTGGGCCTTGG - Intronic
1198874133 X:141204490-141204512 GGGTATAAAAATTTGGAAATGGG - Intergenic
1200637317 Y:5672712-5672734 GAGTGAAAAAAGTTGGTTTTTGG - Intronic
1201407029 Y:13659879-13659901 GGGTGTCAAAAGTTTAACTCGGG + Intergenic
1201917011 Y:19192745-19192767 GGGTTTGAAAAGTGGGAATTTGG - Intergenic