ID: 996946688

View in Genome Browser
Species Human (GRCh38)
Location 5:129078930-129078952
Sequence AGAGGTGTAATGGCCTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996946688_996946693 8 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946693 5:129078961-129078983 CATTCTTCTTCATAAACTGCTGG No data
996946688_996946696 19 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946696 5:129078972-129078994 ATAAACTGCTGGAGCCAGGGTGG No data
996946688_996946699 28 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data
996946688_996946698 27 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946698 5:129078980-129079002 CTGGAGCCAGGGTGGAAGAAGGG No data
996946688_996946695 16 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946695 5:129078969-129078991 TTCATAAACTGCTGGAGCCAGGG No data
996946688_996946694 15 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG No data
996946688_996946697 26 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946697 5:129078979-129079001 GCTGGAGCCAGGGTGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996946688 Original CRISPR AGAGGTGTAATGGCCTATTT GGG (reversed) Intergenic
No off target data available for this crispr