ID: 996946692

View in Genome Browser
Species Human (GRCh38)
Location 5:129078958-129078980
Sequence GCAGTTTATGAAGAAGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996946692_996946697 -2 Left 996946692 5:129078958-129078980 CCTCATTCTTCTTCATAAACTGC No data
Right 996946697 5:129078979-129079001 GCTGGAGCCAGGGTGGAAGAAGG No data
996946692_996946701 21 Left 996946692 5:129078958-129078980 CCTCATTCTTCTTCATAAACTGC No data
Right 996946701 5:129079002-129079024 GGAAGACACCTTTGCCACATTGG No data
996946692_996946699 0 Left 996946692 5:129078958-129078980 CCTCATTCTTCTTCATAAACTGC No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data
996946692_996946696 -9 Left 996946692 5:129078958-129078980 CCTCATTCTTCTTCATAAACTGC No data
Right 996946696 5:129078972-129078994 ATAAACTGCTGGAGCCAGGGTGG No data
996946692_996946698 -1 Left 996946692 5:129078958-129078980 CCTCATTCTTCTTCATAAACTGC No data
Right 996946698 5:129078980-129079002 CTGGAGCCAGGGTGGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996946692 Original CRISPR GCAGTTTATGAAGAAGAATG AGG (reversed) Intergenic
No off target data available for this crispr