ID: 996946694

View in Genome Browser
Species Human (GRCh38)
Location 5:129078968-129078990
Sequence CTTCATAAACTGCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996946690_996946694 5 Left 996946690 5:129078940-129078962 CCATTACACCTCTCTGAGCCTCA No data
Right 996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG No data
996946687_996946694 16 Left 996946687 5:129078929-129078951 CCCCAAATAGGCCATTACACCTC No data
Right 996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG No data
996946691_996946694 -3 Left 996946691 5:129078948-129078970 CCTCTCTGAGCCTCATTCTTCTT No data
Right 996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG No data
996946688_996946694 15 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG No data
996946689_996946694 14 Left 996946689 5:129078931-129078953 CCAAATAGGCCATTACACCTCTC No data
Right 996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996946694 Original CRISPR CTTCATAAACTGCTGGAGCC AGG Intergenic
No off target data available for this crispr