ID: 996946699

View in Genome Browser
Species Human (GRCh38)
Location 5:129078981-129079003
Sequence TGGAGCCAGGGTGGAAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996946687_996946699 29 Left 996946687 5:129078929-129078951 CCCCAAATAGGCCATTACACCTC No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data
996946691_996946699 10 Left 996946691 5:129078948-129078970 CCTCTCTGAGCCTCATTCTTCTT No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data
996946688_996946699 28 Left 996946688 5:129078930-129078952 CCCAAATAGGCCATTACACCTCT No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data
996946689_996946699 27 Left 996946689 5:129078931-129078953 CCAAATAGGCCATTACACCTCTC No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data
996946690_996946699 18 Left 996946690 5:129078940-129078962 CCATTACACCTCTCTGAGCCTCA No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data
996946692_996946699 0 Left 996946692 5:129078958-129078980 CCTCATTCTTCTTCATAAACTGC No data
Right 996946699 5:129078981-129079003 TGGAGCCAGGGTGGAAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996946699 Original CRISPR TGGAGCCAGGGTGGAAGAAG GGG Intergenic
No off target data available for this crispr