ID: 996949597

View in Genome Browser
Species Human (GRCh38)
Location 5:129109824-129109846
Sequence TTCTACAGGAATAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996949597 Original CRISPR TTCTACAGGAATAGAGAGGA AGG (reversed) Intronic
900249089 1:1657417-1657439 TTCTTCAGGAAAAGAAACGAAGG - Exonic
900260035 1:1722750-1722772 TTCTTCAGGAAAAGAAACGAAGG - Exonic
900758281 1:4453080-4453102 TTTTATAGAAATAGAGAGTAGGG + Intergenic
900788096 1:4662305-4662327 ATTTACAGGAATAGTGAGGATGG - Intronic
903400068 1:23036753-23036775 TTCTAGAGGCATATAGAGGTAGG + Intronic
903764493 1:25725397-25725419 TGCTACGGGAATACAGAGGAAGG + Intronic
904153054 1:28458996-28459018 TACCACAGGAAGAGAGGGGAAGG + Intronic
904205156 1:28849647-28849669 TTCTCCAGGATAAGAGAGGAAGG + Intronic
906923434 1:50089246-50089268 GGCTACAGGAGCAGAGAGGAGGG + Intronic
907343028 1:53750705-53750727 TTCTAGGGGAAAGGAGAGGAAGG - Intergenic
907415316 1:54310366-54310388 TTCTAAAGGCATTGAGAGCATGG + Intronic
907652775 1:56311562-56311584 TTCGACTGCAATATAGAGGATGG - Intergenic
908064676 1:60389932-60389954 TTATAAGGGAATAGAGAAGATGG - Intergenic
909487518 1:76190220-76190242 TTCTACCCTAATAGATAGGAGGG + Intronic
909541153 1:76792879-76792901 TTCCCTAGGAAAAGAGAGGAAGG - Intergenic
910671624 1:89779109-89779131 TTCTTGAGGACTAGAGAGAAGGG + Intronic
911551232 1:99283632-99283654 TTATGCAGCAATAGAGCGGAGGG - Intronic
912483918 1:110008805-110008827 TTCTGCAGGATTTGGGAGGAGGG - Intronic
915371876 1:155358211-155358233 TTCCACTGGAATAGAAATGATGG + Intronic
915933251 1:160073596-160073618 TGATAGTGGAATAGAGAGGAAGG - Intergenic
916163278 1:161940909-161940931 TACAACAAGAATAAAGAGGAAGG - Intronic
918306451 1:183251103-183251125 GTCTGCAGGAACAGAGAGGAAGG + Exonic
919840418 1:201605229-201605251 GTCTAAAGGAGCAGAGAGGATGG - Intergenic
920718354 1:208363115-208363137 TTATACATGAATAGAGAGGTAGG - Intergenic
920910444 1:210211473-210211495 ATTTTCAGGAAAAGAGAGGAGGG - Intergenic
923265025 1:232306139-232306161 TTCTAAAGGAACAGAGCAGAGGG - Intergenic
924492307 1:244550472-244550494 ATCTACAGGCATAAACAGGACGG - Intronic
924683789 1:246266367-246266389 TACTTTAGGAATACAGAGGAAGG - Intronic
1062808218 10:441057-441079 TGCTGCAGGGACAGAGAGGAGGG - Intronic
1063616820 10:7607477-7607499 CTCTACAGAAAGAAAGAGGAGGG + Intronic
1063851305 10:10194874-10194896 TTCCACGGGAATAAAGAAGAAGG - Intergenic
1063944353 10:11162515-11162537 CTCTGTAGGAATAGAGAAGAAGG + Intronic
1064256007 10:13743274-13743296 TTCTGCAGGATTAGTGAGGCTGG - Intronic
1065137456 10:22686109-22686131 TTCCACAGTGATAGACAGGATGG - Intronic
1065345120 10:24741198-24741220 TTCTGCAGAAATATATAGGAAGG + Intergenic
1066646074 10:37610658-37610680 TGCTACAGGAAAAGAAAGGAGGG - Intergenic
1067338769 10:45384356-45384378 TTTTACAGCAGTAGAGAGAATGG - Intronic
1067900727 10:50238707-50238729 TTCTTTAGGAATAAATAGGATGG - Intronic
1071597258 10:86937305-86937327 TTTTTCACTAATAGAGAGGAAGG + Intronic
1071764362 10:88645634-88645656 TGCTACAGAAAGGGAGAGGATGG + Intergenic
1071878679 10:89870666-89870688 TTCAACAGGTATACAAAGGAGGG - Intergenic
1072470194 10:95706680-95706702 AGCCACAGGACTAGAGAGGATGG - Intergenic
1072524448 10:96259168-96259190 GTCTCCAGGGACAGAGAGGAAGG - Intronic
1072552182 10:96487417-96487439 TCCTAAAGGAATACAGAGAAAGG - Intronic
1072936408 10:99717682-99717704 ATTTAAAGGAATAGAGAGGCTGG - Intronic
1073919797 10:108445609-108445631 TGCTACAGAAATGTAGAGGAGGG + Intergenic
1074102150 10:110362213-110362235 TGCTACAGGAATATAAAGGCAGG + Intergenic
1075298750 10:121301250-121301272 TTCTGCTGAAATAGAGGGGAAGG + Intergenic
1075362311 10:121849478-121849500 TTCCACAGGAATTGAGAGATGGG - Intronic
1075594838 10:123721500-123721522 TTCCACAGGAAAAGAGAAGCAGG + Intronic
1075879390 10:125837395-125837417 TGCTACATGAATGGAAAGGAGGG - Intronic
1076038226 10:127219642-127219664 TTCTACAGGTGCTGAGAGGAGGG - Intronic
1076768185 10:132648512-132648534 TTCTTCAGGCAGAGAGAGAAGGG - Intronic
1077555263 11:3222900-3222922 CTATACAGGAAAGGAGAGGAGGG + Intergenic
1079169802 11:18081951-18081973 TCCAAAAGCAATAGAGAGGAAGG - Intronic
1080266845 11:30409946-30409968 TTCTACAGGAACAGAGAGACTGG - Intronic
1083469669 11:62875227-62875249 TTCTAAAGGCAGAGAGAAGATGG - Intronic
1084899083 11:72296133-72296155 TGCTGCAGGAATTCAGAGGAGGG + Intronic
1085210732 11:74775319-74775341 TTGTCCAAAAATAGAGAGGAGGG - Intronic
1085851865 11:80130116-80130138 TTATCAAGGAATGGAGAGGAGGG - Intergenic
1090015809 11:123085551-123085573 TTATTCAGGAATAGAATGGAAGG - Intronic
1090074809 11:123573377-123573399 TTTGACAGGAAAAGAGAGAATGG + Intronic
1090201352 11:124859940-124859962 CTTTAAAAGAATAGAGAGGATGG + Intergenic
1091060111 11:132453120-132453142 TTCTACAGGAACCCAGATGAGGG - Intronic
1091437385 12:483229-483251 ATCTAAAGGAATATATAGGATGG - Intronic
1092115543 12:5999521-5999543 TTCTATACTAATAGAAAGGAGGG + Intronic
1092399090 12:8157450-8157472 TTCTCAAGGAAGTGAGAGGAAGG - Intronic
1093005353 12:14045195-14045217 TTCTACAGGAATGGAACAGAGGG + Intergenic
1093083410 12:14839840-14839862 CTCTCCAGGAAAAGTGAGGAAGG - Intronic
1093096542 12:14978261-14978283 TTACAGAGGAAAAGAGAGGATGG - Intronic
1093806619 12:23440901-23440923 TTCTACAGGAGCACAGAGGGTGG - Intergenic
1095504894 12:42885428-42885450 TTCTACAAGGATAGGGATGATGG - Intergenic
1095906560 12:47384141-47384163 GTCTACAGGAACAGGAAGGAAGG + Intergenic
1097034807 12:56116754-56116776 TTCTACAGGGAAAGAGAGAAAGG - Exonic
1097055210 12:56244988-56245010 TCCTAGAGGAAGAGGGAGGAGGG + Exonic
1097432017 12:59520885-59520907 AGCTACAGGAATAGACAGGATGG + Intergenic
1098030397 12:66247776-66247798 TTCTCCAGGAATAGAGGAGAAGG - Exonic
1099363901 12:81743622-81743644 TTGTCCAGGAATAGCAAGGAGGG + Intronic
1100104232 12:91148942-91148964 CACTACTGGAATATAGAGGATGG - Intronic
1100186250 12:92144240-92144262 TCCTACAGAATTGGAGAGGATGG - Exonic
1100593494 12:96051771-96051793 CCCTTCAGGAAAAGAGAGGAAGG + Intergenic
1101041509 12:100760639-100760661 TTTTACAAGACTAGAGGGGAAGG - Intronic
1101412344 12:104480041-104480063 TTCTAAAGGAAGACAGAGAATGG + Intronic
1102969474 12:117155157-117155179 TTCAACAGGAACAAAGAGAAGGG + Intronic
1103642082 12:122359660-122359682 TTCTACCTGAACATAGAGGAAGG + Intronic
1104302947 12:127582020-127582042 TTCATCAGGAACAGAAAGGAGGG + Intergenic
1104374243 12:128250004-128250026 TCCAACAAGAAGAGAGAGGAAGG - Intergenic
1105671747 13:22626051-22626073 TTCAACAGGAACAAAGAGAAAGG + Intergenic
1108418891 13:50228715-50228737 ATCCAGAGGAGTAGAGAGGATGG - Intronic
1108460397 13:50660801-50660823 TTCTCCAGGAATAAAGGGAAAGG - Intronic
1108706185 13:52990339-52990361 ATCCACAGGCATTGAGAGGAAGG - Intergenic
1110495768 13:76165971-76165993 TTCTACTGCAATACAGAAGAGGG + Intergenic
1112927349 13:104692962-104692984 ATCAACAGGAATAGAGAAGGAGG - Intergenic
1112973790 13:105292063-105292085 TTCTACAGTTGTAAAGAGGAAGG + Intergenic
1113085395 13:106565034-106565056 TTACACAGGAGTAGTGAGGATGG - Intronic
1113627727 13:111858751-111858773 TTCTACAGGGAGCGTGAGGACGG - Intergenic
1114265147 14:21069452-21069474 TTCTAGCCGAATAGAGAGGTAGG + Intronic
1114826386 14:26085978-26086000 TTATACAGGAATGAAGAGAAAGG + Intergenic
1114859949 14:26504853-26504875 TTCTAGAGGAAGAGATAGGGTGG + Intronic
1118201271 14:63676075-63676097 TTAGACAGGAAAAGAGGGGAAGG + Intergenic
1119756419 14:77123205-77123227 TGATACAGGTATAGAGAGGAAGG + Intronic
1119987827 14:79159538-79159560 TTCTTCAGAAATTGAGTGGATGG + Intronic
1122647079 14:103201971-103201993 CTCTACAGGACTACGGAGGAGGG + Intergenic
1124052096 15:26206442-26206464 TTCTTCAGTAATTGACAGGATGG - Intergenic
1125594822 15:40878024-40878046 TTCTAGAGGAATACAAAGGCAGG - Intergenic
1126198646 15:45959817-45959839 TTCTACAGAATTAGAGAGTTTGG + Intergenic
1126256914 15:46638512-46638534 TTTGACAGGAAGACAGAGGAGGG + Intergenic
1126786381 15:52180348-52180370 TCCTGCAGGCAGAGAGAGGACGG + Intronic
1128153149 15:65376228-65376250 TTCTGCAGGAGCAGAGAGGTTGG - Intronic
1130202091 15:81841590-81841612 TTTTACAGAAATAGAAAGTAAGG + Intergenic
1130730891 15:86491141-86491163 TTTTACAGGGATACAGAAGAGGG + Intronic
1133419055 16:5630134-5630156 TTCTGCAGGAGTAGAGATCAAGG + Intergenic
1133726664 16:8543723-8543745 TTCTACAGGAGGAGAGAGACAGG - Intergenic
1134511362 16:14850338-14850360 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134699006 16:16248835-16248857 TTCTAGAGAAAGAGGGAGGAGGG + Intronic
1134972831 16:18545838-18545860 TTCTAGAGAAAGAGGGAGGAGGG - Intronic
1137353490 16:47735170-47735192 TTCCACAGTAAAAGAGAGGAAGG - Intergenic
1138029594 16:53549617-53549639 TTCCACAGGAATAGTGAGAGAGG - Intergenic
1138121960 16:54407591-54407613 TTCTTCAGGACTAGAGAGGTGGG + Intergenic
1138162821 16:54771967-54771989 TGCAATAGGAACAGAGAGGAGGG - Intergenic
1139153910 16:64417966-64417988 TGTTACAGGAATACAGAGAATGG + Intergenic
1139398574 16:66661310-66661332 AGCTACAGGAATATAGAGTAGGG + Intronic
1140059185 16:71553243-71553265 TTCTTCAGCACTAGAGAAGATGG - Intronic
1141974239 16:87504307-87504329 TTCCACAGGAATACACAGGTGGG - Intergenic
1143516289 17:7420818-7420840 TCCTACAGGCATGGAGAGGCAGG - Intronic
1145918685 17:28593375-28593397 TTCTAGATGAACAGATAGGAGGG + Intronic
1146071877 17:29689683-29689705 TTCTTCAGGAATAAAGAGGCAGG - Intronic
1146712429 17:35054193-35054215 CTCTACACGGTTAGAGAGGAAGG - Intronic
1146923769 17:36730463-36730485 AACTACAGGAGTACAGAGGAGGG + Intergenic
1147170943 17:38618492-38618514 TTCCACATCAATAGAAAGGAGGG - Intergenic
1148845914 17:50529713-50529735 CTCTAGGGGAACAGAGAGGAAGG + Intronic
1149219609 17:54401366-54401388 TTCCACAAGAAAATAGAGGAAGG + Intergenic
1150771119 17:68041832-68041854 TTCTGCAGGGATGGAAAGGAGGG + Intronic
1151169210 17:72232749-72232771 TTCTACATGGTTAGAGAGAAAGG - Intergenic
1153366391 18:4261602-4261624 TGCTACAGGATTCCAGAGGAGGG - Intronic
1154412607 18:14149414-14149436 TTGTACCGGTATAGGGAGGAGGG + Intergenic
1155169384 18:23256033-23256055 TTCTGCATCAATAGTGAGGAAGG - Intronic
1155334125 18:24747824-24747846 TTCTATGGGACTTGAGAGGAAGG - Intergenic
1156450435 18:37263505-37263527 TTCCATAGGGGTAGAGAGGATGG + Intronic
1156724268 18:40109119-40109141 TTCTCCCGGAACACAGAGGATGG - Intergenic
1157542643 18:48522713-48522735 TTCTACACGTATTTAGAGGAGGG + Intergenic
1158624619 18:59060422-59060444 TTCAAAAGGATGAGAGAGGATGG - Intergenic
1159685088 18:71409265-71409287 TTTTGCAGGGATAGAGAGGCAGG - Intergenic
1159857678 18:73608287-73608309 TGCTAGAGGAATAGGGATGAGGG - Intergenic
1160431418 18:78815597-78815619 TTCTAGCTGAACAGAGAGGAAGG + Intergenic
1161331991 19:3692835-3692857 TTTTAGAGGAACAGTGAGGAGGG - Intronic
1163180089 19:15593094-15593116 ATCTGCAGGAATAGATAGAAAGG - Intergenic
1164655307 19:29916789-29916811 TTCTAGGGGAGTAGAGATGAAGG - Intergenic
1166644253 19:44519496-44519518 TTCTGCAGGGAGAGAAAGGAGGG - Intronic
1167345631 19:48944066-48944088 TTCTTAAGGTCTAGAGAGGAGGG - Intronic
1168072644 19:53961503-53961525 TTCTAAAGCAAAAGAGAGGGTGG + Intergenic
1168548020 19:57269908-57269930 TTCCACAGGAAAAGAAAGGCAGG - Intergenic
925363718 2:3296683-3296705 TTCTGTAGGCAGAGAGAGGACGG - Intronic
925556812 2:5140096-5140118 TTCTAAAATAATAAAGAGGAAGG - Intergenic
925614001 2:5728066-5728088 TTCTAGATGAAAAGAGATGAAGG - Intergenic
925741739 2:7010805-7010827 CACTACAGGGGTAGAGAGGAGGG - Intronic
926923502 2:17963021-17963043 TTCTACCGGAAGAAAGGGGAAGG + Intronic
930256436 2:49098610-49098632 TGCTACTTGAATGGAGAGGAAGG + Intronic
930885229 2:56317936-56317958 TACTACAAGAATAAAGAAGATGG - Intronic
931549076 2:63422869-63422891 TTTTACAGAAAAAGAAAGGATGG + Intronic
933302447 2:80557441-80557463 TTGTACAAGAATAGAGCTGATGG - Intronic
933451655 2:82460862-82460884 TTCTAGAGGAATAGAGCTTAAGG + Intergenic
933467021 2:82665234-82665256 TTCTACAGGTCTAAAGAGCAAGG + Intergenic
934856140 2:97731586-97731608 CTGTCCAGGAATGGAGAGGATGG + Intronic
936904062 2:117516441-117516463 TGCTACACAAATAGAGAGGGTGG + Intergenic
939411591 2:141833791-141833813 GGCTAAAGGAATAGAGATGAGGG + Intronic
939423643 2:142006077-142006099 TTAGACAGGAAAAGAGAGAAGGG - Intronic
939589456 2:144045776-144045798 GTGTGCAGGAAGAGAGAGGAAGG + Intronic
941551339 2:166919067-166919089 ATCTCCAGGAAGAGAGTGGATGG - Intronic
941926652 2:170902305-170902327 TTATAAAGGTATAGAAAGGAAGG + Intergenic
942100920 2:172582686-172582708 TTCTTCAGGAAAAGGGAGGGAGG - Intronic
942279161 2:174343472-174343494 TTCTACAGGAAGAGAGTATAAGG - Intergenic
942898411 2:181086033-181086055 CTGTAGAGGAATAGAGAGGATGG + Intergenic
943344223 2:186718528-186718550 TATTACAGGGATAGAGAAGAGGG - Intronic
943533853 2:189122392-189122414 TAAAACAGGAATAGAGAGGGAGG + Intronic
943537594 2:189171871-189171893 TGCTACAGGAAAAGAGAAGAAGG + Intronic
943595554 2:189850878-189850900 TTATACGGGATTAGAGATGAAGG + Intronic
943706734 2:191043077-191043099 ATATACAGGAATAGAGAATACGG - Intronic
943722606 2:191220741-191220763 TTCTACATTAGTAGAGATGAGGG + Intergenic
944396217 2:199270133-199270155 TACTACAGAAATAGGAAGGATGG + Exonic
944427218 2:199595622-199595644 CTGTCCAGGAAGAGAGAGGAGGG + Intergenic
945457542 2:210066744-210066766 TTATACAGCAATAAAAAGGATGG - Intronic
946060375 2:216936105-216936127 TTCTACAGAAAAGAAGAGGAAGG + Intergenic
947380409 2:229540100-229540122 TTCTACAGTACTTCAGAGGAGGG + Intronic
947668874 2:231924562-231924584 GGCGGCAGGAATAGAGAGGAGGG + Intronic
1169503993 20:6188726-6188748 TTCTCCAGGAATACAAATGAGGG - Intergenic
1170729590 20:18961762-18961784 TACCACAGAAATACAGAGGAAGG - Intergenic
1171779582 20:29407356-29407378 TTCTAAAGGAAGAAAGAGAAAGG + Intergenic
1173194121 20:40899974-40899996 TTCTGCAGGGACAGAGAGAAGGG - Intergenic
1173434325 20:43018867-43018889 TTTTACAGGATTAGGGAGAATGG + Intronic
1174495848 20:50942112-50942134 TTCTACAGGAAGCAAAAGGAGGG - Exonic
1174750882 20:53110395-53110417 TGCTAAAGGGATAGAGAAGAAGG - Intronic
1174860756 20:54088916-54088938 TTCCACATGAGCAGAGAGGAGGG - Intergenic
1175148867 20:56917348-56917370 TTCAACAGAAAGAGAGAGGGAGG - Intergenic
1175455527 20:59109763-59109785 TTCTGCAGGAATAAAGAAGGTGG + Intergenic
1176860399 21:14008841-14008863 TTGTACCGGTATAGGGAGGAGGG - Intergenic
1178067314 21:28919241-28919263 ATCCACCGTAATAGAGAGGAGGG + Intergenic
1179642955 21:42759137-42759159 TTCCACAGGAATGGAGGGAATGG + Intronic
1182634248 22:31711875-31711897 TTCTACAGGAAAACTGAGCAGGG + Intronic
1183277819 22:36912313-36912335 TTCTCCAGGGCTGGAGAGGATGG - Intergenic
1185056916 22:48585996-48586018 TTCTGGAGGAAGGGAGAGGAGGG + Intronic
1203309983 22_KI270736v1_random:135969-135991 ATGTACAGGAATGGATAGGAAGG + Intergenic
949338572 3:3004329-3004351 TTTTCTAGGAATAGAGTGGAGGG - Intronic
949338588 3:3004416-3004438 TGTCACAGAAATAGAGAGGAAGG - Intronic
949923178 3:9020417-9020439 TGCTACAGGGATAGAGAGGGAGG - Intronic
950009497 3:9712803-9712825 TTCTACAGGAGCAATGAGGATGG + Exonic
951081116 3:18451035-18451057 TTCTCCAGGCAGAAAGAGGAGGG + Intergenic
953837379 3:46358530-46358552 TTCTACAGGGAGACAGTGGATGG + Intronic
954436233 3:50497806-50497828 TTCCACAGGACAAGAGAAGAAGG + Intronic
955075114 3:55606486-55606508 TGCTACATGGACAGAGAGGAAGG - Intronic
956586123 3:70866893-70866915 TTCTGCAGGGAAAGAGATGAAGG - Intergenic
956694552 3:71907285-71907307 TTCTGCAGGAAGAGAGGAGAGGG - Intergenic
957364739 3:79208304-79208326 TTTTACAAGAATAAAAAGGATGG - Intronic
957372038 3:79307055-79307077 TTCTTCAGGAAAAGAAGGGAGGG + Intronic
957438428 3:80210484-80210506 TTCTACAGCAAGAAAGAGAAAGG - Intergenic
957979765 3:87494140-87494162 ATCTCTAGGAAAAGAGAGGAAGG + Intergenic
958699426 3:97569065-97569087 TTCTATAAGAATAGATATGAAGG + Intronic
958926207 3:100160290-100160312 TTCTACAGAAAGAGAGATGCTGG - Intronic
959331889 3:105016596-105016618 TGCTACAGGAACACAGAGAAAGG + Intergenic
960554544 3:119013004-119013026 TTCTACATGACTGGAGAGTAGGG - Intronic
963192259 3:142485792-142485814 TTCTGAAGGAATTGAGAGAAAGG - Intronic
963321264 3:143812005-143812027 TTCCTAAGGAATAGAGGGGAAGG + Intronic
963966102 3:151372419-151372441 TTGTTCAGGAATAGAGAGAATGG - Intronic
965052866 3:163673044-163673066 TCCTAGAGGAATAGAAAGGTAGG - Intergenic
965354580 3:167657790-167657812 TGCTACAGGAAGAGAAAGAAAGG + Intergenic
965407299 3:168286045-168286067 GTCTCCAAGAATAGAAAGGAGGG + Intergenic
966662915 3:182434528-182434550 GGTTACAGGAACAGAGAGGAAGG + Intergenic
967463714 3:189777653-189777675 TTCTATGGGAACAGAGAGAAAGG - Intronic
968176017 3:196550010-196550032 TTTTACAGGCTTATAGAGGAAGG + Intergenic
969986488 4:11216978-11217000 TTCTAATGGAAAAGAAAGGAAGG - Intergenic
970188824 4:13491094-13491116 TTTTTCAGGAGTACAGAGGAAGG + Intergenic
970931117 4:21513173-21513195 TTCTCCAGTAACAGAGATGAAGG + Intronic
971051749 4:22869808-22869830 TTCTAAAGGAATTGAGAGTGTGG - Intergenic
972377377 4:38485564-38485586 TTCTCCAGGAAGAGAGACCATGG - Intergenic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
975144562 4:70953402-70953424 TTCTGCAGGAATAAAGCAGACGG + Intronic
975185416 4:71396750-71396772 TCATACACAAATAGAGAGGAAGG - Intronic
975481390 4:74884432-74884454 TTCTAATGGAAGAGAGAGAAGGG - Intergenic
976366472 4:84238581-84238603 TTCAATAGGAATAGAAAGGACGG + Intergenic
976628103 4:87208196-87208218 TTCTACATGGAAAGTGAGGAGGG - Intronic
977313837 4:95419909-95419931 TCTTACAGAAATAGACAGGATGG + Intronic
977659177 4:99563267-99563289 TTCTACAGATATGAAGAGGATGG - Intronic
978686311 4:111448491-111448513 ATTTAAAGGAATAGGGAGGATGG + Intergenic
978994825 4:115138111-115138133 TTCTAGAGTAATAGAAAGGAAGG + Intergenic
979184681 4:117773101-117773123 TTCTACACGAAGAAAGAAGAGGG + Intergenic
979544659 4:121926278-121926300 TTTTAAAGGAAAAGTGAGGAGGG - Intronic
980132296 4:128828010-128828032 TTCTACAGGAATACAAAAGGTGG - Intronic
980289132 4:130823128-130823150 TTAAAAAGGAATAGTGAGGATGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982526336 4:156483926-156483948 TCCAATAGGAATGGAGAGGAGGG - Intergenic
983159929 4:164399871-164399893 TGCTATAGGAATCTAGAGGAGGG - Intergenic
984193954 4:176636074-176636096 TCCTTCAGGAAATGAGAGGAAGG - Intergenic
984257856 4:177408873-177408895 TTTTACACGGATAGAGAGGAAGG - Intergenic
984604663 4:181771196-181771218 TTCTACAGAAATAGAAAGAGAGG + Intergenic
984912283 4:184685391-184685413 TTCTACTGCAACAGAGAGAATGG - Exonic
984954924 4:185035817-185035839 AGCTGCAGGAATAGAGAAGACGG - Intergenic
985618907 5:942595-942617 TTCTAGAAGAAAACAGAGGAAGG - Intergenic
986021921 5:3812513-3812535 TTCACCAGGAAAAGAGAGGGAGG + Intergenic
986293449 5:6418335-6418357 TTTTACAGGAAGAGAAATGAAGG + Intergenic
987368409 5:17170938-17170960 CTGTACAGGAATAGACAAGACGG - Intronic
987956589 5:24749008-24749030 TATAAAAGGAATAGAGAGGAGGG - Intergenic
988973612 5:36493628-36493650 TGCTACAAAAATAAAGAGGAAGG - Intergenic
989530287 5:42499990-42500012 TTTTACAGGAGTGGAGGGGAGGG - Intronic
989575851 5:42987412-42987434 TTCTTTAGGAATAGAATGGAAGG + Intergenic
989998847 5:50868615-50868637 TTATACAAGAAAAGAGAGGGAGG - Intergenic
990345169 5:54864824-54864846 TTCTATAGGAATACTGTGGAAGG + Intergenic
990626292 5:57615266-57615288 TTCTCCAGGAAAAGAGAGTTTGG + Intergenic
991226231 5:64276259-64276281 TTCTGCCTGAATGGAGAGGAAGG + Intronic
991354962 5:65759239-65759261 TTATACAGCATTACAGAGGATGG - Intronic
993002176 5:82392295-82392317 TTCAACGGGATTAGAGATGAAGG - Intergenic
993560120 5:89396282-89396304 ATCTACAGTACTAGATAGGAAGG - Intergenic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
994687226 5:102970423-102970445 TTGTAAAGGAAGAGAGAAGATGG + Intronic
995190511 5:109314811-109314833 TTTTACAGAAATACAGAGGCTGG + Intergenic
996461259 5:123745867-123745889 ATGTTAAGGAATAGAGAGGACGG - Intergenic
996554576 5:124764594-124764616 TTCTACTGGATAAGAGAGTATGG - Intergenic
996949597 5:129109824-129109846 TTCTACAGGAATAGAGAGGAAGG - Intronic
998073164 5:139214882-139214904 GTCCACAGGAGTAGAGAGTAGGG - Intronic
1000689607 5:164299618-164299640 TTCTAAAGAAATTGAGAGGAGGG - Intergenic
1001308515 5:170593853-170593875 TTCTACAGTAATAGCTGGGAAGG - Intronic
1002110191 5:176903778-176903800 TTCTTCAGGAATGAAGAGTAGGG + Intergenic
1002846314 6:948281-948303 TTCTATGGGAATAGAAAGTATGG + Intergenic
1004498107 6:16183675-16183697 TTCTACAGGCATTGAAAGGTTGG - Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1005075485 6:21902603-21902625 TTCTAGATGAAAAGAAAGGAGGG + Intergenic
1006140236 6:31924348-31924370 CTCTACAGGATTGGAGAGCAGGG + Intronic
1007512167 6:42381883-42381905 TTCCACAGGACTGAAGAGGAGGG + Intronic
1008246455 6:49179992-49180014 TTCTAAATGCATAGGGAGGAAGG - Intergenic
1009369407 6:62881286-62881308 ATATCCAGGAATAAAGAGGATGG + Intergenic
1010521516 6:76843909-76843931 TTCTAGATGAAAAGAAAGGAAGG + Intergenic
1011234203 6:85197867-85197889 TCCTTCAGGCAGAGAGAGGAGGG + Intergenic
1012713030 6:102632497-102632519 TTCTAGTGGAATAGAAAGCATGG + Intergenic
1015012604 6:128369194-128369216 TTCTTCAGGAATATAGAAGTGGG - Intronic
1015106893 6:129547496-129547518 TTTTACAGCAAGAGAAAGGAGGG + Intergenic
1015806570 6:137115805-137115827 TACAACAGGCAGAGAGAGGAAGG - Intergenic
1017760196 6:157562549-157562571 TTCTCCAGGTACAGAGAGGGAGG + Intronic
1017941824 6:159060208-159060230 CTCTGCAGGAATGGAGAGGTTGG + Intergenic
1018665215 6:166129261-166129283 TTCTACAGCTATTGGGAGGAGGG - Intergenic
1019864156 7:3689315-3689337 TCCAACAGGAACAGGGAGGAGGG - Intronic
1020438124 7:8188329-8188351 TGCTACAAGAATGGAGAGGAGGG - Intronic
1020826865 7:13039662-13039684 TTTTAAAGGATTGGAGAGGAAGG - Intergenic
1022545054 7:31179178-31179200 TTATACACGAATAAAGAGAATGG + Intergenic
1023095348 7:36654611-36654633 TGCTGCAGGGATGGAGAGGATGG - Intronic
1023485444 7:40681505-40681527 TTTTGCAGGAGTAGAAAGGAAGG + Intronic
1024405701 7:48976789-48976811 TTCTACACCAAAAGAGTGGATGG + Intergenic
1026213410 7:68326989-68327011 ATCTACAAGAAGAGAGAGGAAGG + Intergenic
1028412026 7:90540239-90540261 TTCTATGGTAATAGAAAGGAAGG - Intronic
1029019725 7:97351806-97351828 TTTTACAGGAAAAGAGAGGGAGG + Intergenic
1029196133 7:98806781-98806803 TTCTCCAGGAAGAGGGGGGATGG - Intergenic
1029345647 7:99976540-99976562 TTCCACAGGCACAGAAAGGAAGG - Intergenic
1029679857 7:102101005-102101027 TGCCACAGGACAAGAGAGGAGGG + Intronic
1029993698 7:104985619-104985641 TTCAACAGGAATAGAGAGGACGG + Intergenic
1030102914 7:105962143-105962165 TTTTGCAGCAATAGAAAGGAAGG - Intronic
1031116985 7:117679717-117679739 TTCTAAAGGAAAGGAGAGAAAGG + Intronic
1031624349 7:123975020-123975042 TTTTACAGGAAAAGATATGAAGG - Intergenic
1032260061 7:130328464-130328486 TTTTGCAGTAATGGAGAGGATGG + Intergenic
1032418849 7:131761684-131761706 TGCTACGGGAAGTGAGAGGAGGG + Intergenic
1033814551 7:145056054-145056076 TACTGAAGGATTAGAGAGGAAGG + Intergenic
1033826993 7:145203828-145203850 TGCAAAAGGAACAGAGAGGAGGG - Intergenic
1035025081 7:155819947-155819969 TCCACCAGGAATACAGAGGAGGG + Intergenic
1036169556 8:6469848-6469870 TTCTAAAGGAGTAGAGATGAGGG - Intronic
1036956472 8:13193059-13193081 TTGGATAGGAACAGAGAGGAGGG - Intronic
1037266192 8:17063066-17063088 TTCTACAGGAATAGTGACACAGG + Intronic
1037626384 8:20610958-20610980 TGCTACAGGAGTAAAAAGGAAGG + Intergenic
1039432323 8:37534655-37534677 TCATCCAGGAAAAGAGAGGACGG + Intergenic
1043343138 8:79266391-79266413 TTCTACAGGCATAAAGAAAAAGG - Intergenic
1045704151 8:104900618-104900640 GTCTATAGGAATGGGGAGGACGG - Intronic
1045855049 8:106755381-106755403 GTGTACAGGAGGAGAGAGGATGG - Intergenic
1046023094 8:108689870-108689892 TTCTGGAGAAATGGAGAGGAGGG - Intronic
1046572093 8:115979177-115979199 TTCTACAGGGATAAAGAGGAGGG - Intergenic
1047978126 8:130151822-130151844 TTCTGCAGGAAGAGAGAGAAAGG + Intronic
1048890767 8:138944389-138944411 TTCGTGAGGATTAGAGAGGATGG + Intergenic
1049913840 9:297090-297112 TTGTACAGGAAGGGAGAGAAGGG + Intronic
1052383448 9:27796944-27796966 TTCTACGTGAATAGAGATGGGGG + Intergenic
1054740090 9:68797248-68797270 TGCTACAGGAACCCAGAGGAAGG + Intronic
1055582638 9:77723397-77723419 ATCTAAAGGAATTGAGAGCAGGG + Intronic
1058746570 9:107997285-107997307 TTCTAAAGAAATAGAAATGAAGG - Intergenic
1059075241 9:111185977-111185999 TTAGACAGGAATAGAAATGAGGG + Intergenic
1059692098 9:116695506-116695528 TTCTCCAGGCATAGAGAAGAAGG - Intronic
1059823529 9:118000459-118000481 TTCTACAGAACAAGAGAAGAGGG - Intergenic
1059917816 9:119123347-119123369 TTCAAAAGTAATAAAGAGGAGGG - Intergenic
1060443362 9:123662812-123662834 TTCTAAAGGTATAGAAAGAATGG + Intronic
1061905732 9:133695965-133695987 TTCTGGAAGAGTAGAGAGGAAGG + Intronic
1062078753 9:134607433-134607455 TAAAACAGGAATGGAGAGGAGGG - Intergenic
1186012449 X:5150138-5150160 TACTAGAGAAATAGAGATGAAGG + Intergenic
1186402587 X:9273548-9273570 TTCTACAGGGAGGAAGAGGAAGG + Intergenic
1186415590 X:9380633-9380655 TACTACTGGCATATAGAGGATGG - Intergenic
1186434707 X:9532761-9532783 TCCAACAGGACTAGAGATGAGGG - Intronic
1187854565 X:23624381-23624403 TTCTGCAGCAATAGAAAAGAAGG - Intergenic
1187882600 X:23860821-23860843 TTTTAAAGGAATAGAGATGGGGG - Intronic
1187897275 X:23994085-23994107 TTTTACCTGAATAGAGAGGGTGG - Intronic
1189528028 X:41847201-41847223 TTCAAAAGGAATGGAGAGAAAGG - Intronic
1189669158 X:43389163-43389185 TTTTTCAGGAATAGAGTGGGAGG + Intergenic
1189730241 X:44012613-44012635 TTCTTCAGGATGAGGGAGGAAGG + Intergenic
1190594991 X:52043527-52043549 TCTTACAGGAACAAAGAGGAGGG - Intergenic
1190613833 X:52210546-52210568 TCTTACAGGAACAAAGAGGAGGG + Intergenic
1190919170 X:54834604-54834626 TTTTACAGGAACAGAGAAGCTGG - Intergenic
1193772265 X:85601992-85602014 TGCTACAGGAAGACAGAGAAAGG + Intergenic
1193864611 X:86715758-86715780 TATTACAGGAATTTAGAGGAAGG + Intronic
1195017543 X:100794090-100794112 TTCTACAGGAATACTAAAGAAGG - Intergenic
1195154300 X:102107847-102107869 TTCAAAATGAATAGAGAGGTGGG + Intergenic
1195270902 X:103229642-103229664 TTCATCAGGAAAACAGAGGAAGG + Intergenic
1195420636 X:104671522-104671544 TGCTACAGGAGCACAGAGGAAGG - Intronic
1195867577 X:109449828-109449850 TTCCAGAGGAGTAGAGAGAAAGG + Intronic
1196710483 X:118757024-118757046 CTCTGCTGGAAGAGAGAGGAGGG + Intronic
1196919385 X:120569929-120569951 TCCTAAAGGAAGAGAGAGTAAGG + Intronic
1197904062 X:131405156-131405178 TACTACAGGAACAAAGAAGAGGG + Intergenic
1198890304 X:141387351-141387373 TTCTATAGGAAGGTAGAGGAAGG - Intergenic
1200304171 X:155008085-155008107 TTGTACAGCAAAAGAGATGAGGG + Intronic