ID: 996952675

View in Genome Browser
Species Human (GRCh38)
Location 5:129146859-129146881
Sequence TAGGGGTCTTTGGAATTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996952668_996952675 4 Left 996952668 5:129146832-129146854 CCTCTTGGTCTGTCTGAGTTCCA No data
Right 996952675 5:129146859-129146881 TAGGGGTCTTTGGAATTGCTAGG No data
996952666_996952675 27 Left 996952666 5:129146809-129146831 CCGTATGGACATATGTCTTCATT No data
Right 996952675 5:129146859-129146881 TAGGGGTCTTTGGAATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996952675 Original CRISPR TAGGGGTCTTTGGAATTGCT AGG Intergenic
No off target data available for this crispr