ID: 996954202

View in Genome Browser
Species Human (GRCh38)
Location 5:129164083-129164105
Sequence CCTTGTGCTAACACTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996954202_996954211 -1 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954211 5:129164105-129164127 GGTGGGGCACTAGCAGGGGCAGG No data
996954202_996954210 -5 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954210 5:129164101-129164123 CAAGGGTGGGGCACTAGCAGGGG No data
996954202_996954209 -6 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954209 5:129164100-129164122 ACAAGGGTGGGGCACTAGCAGGG No data
996954202_996954214 24 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954214 5:129164130-129164152 TGCTGGCTTTGTGCCCACCAAGG No data
996954202_996954213 7 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954213 5:129164113-129164135 ACTAGCAGGGGCAGGGATGCTGG No data
996954202_996954208 -7 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954208 5:129164099-129164121 CACAAGGGTGGGGCACTAGCAGG No data
996954202_996954212 0 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954212 5:129164106-129164128 GTGGGGCACTAGCAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996954202 Original CRISPR CCTTGTGCTAACACTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr