ID: 996954211

View in Genome Browser
Species Human (GRCh38)
Location 5:129164105-129164127
Sequence GGTGGGGCACTAGCAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996954202_996954211 -1 Left 996954202 5:129164083-129164105 CCAGCAGCAGTGTTAGCACAAGG No data
Right 996954211 5:129164105-129164127 GGTGGGGCACTAGCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996954211 Original CRISPR GGTGGGGCACTAGCAGGGGC AGG Intergenic
No off target data available for this crispr