ID: 996955647

View in Genome Browser
Species Human (GRCh38)
Location 5:129180349-129180371
Sequence AAGCCTAACCATATCAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996955647_996955652 27 Left 996955647 5:129180349-129180371 CCTTGGTTGATATGGTTAGGCTT No data
Right 996955652 5:129180399-129180421 ATTGTAATCCCCATGTGTCAAGG 0: 192
1: 506
2: 1110
3: 1968
4: 3229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996955647 Original CRISPR AAGCCTAACCATATCAACCA AGG (reversed) Intergenic
No off target data available for this crispr