ID: 996956833

View in Genome Browser
Species Human (GRCh38)
Location 5:129193346-129193368
Sequence TAACCAGGGGAGGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996956833_996956839 22 Left 996956833 5:129193346-129193368 CCAGTAGCAGCCTCCCCTGGTTA No data
Right 996956839 5:129193391-129193413 CTAATGCCGTTCTCTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996956833 Original CRISPR TAACCAGGGGAGGCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr