ID: 996958917

View in Genome Browser
Species Human (GRCh38)
Location 5:129220116-129220138
Sequence ACATTGCGCCAGCACTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996958917_996958923 10 Left 996958917 5:129220116-129220138 CCCTTATAGTGCTGGCGCAATGT No data
Right 996958923 5:129220149-129220171 GCCTGTGAGGACTGATAGCAAGG No data
996958917_996958920 -3 Left 996958917 5:129220116-129220138 CCCTTATAGTGCTGGCGCAATGT No data
Right 996958920 5:129220136-129220158 TGTGCTGCCCATGGCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996958917 Original CRISPR ACATTGCGCCAGCACTATAA GGG (reversed) Intergenic
No off target data available for this crispr