ID: 996959584

View in Genome Browser
Species Human (GRCh38)
Location 5:129230956-129230978
Sequence CAATTAACACGACTACGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996959584_996959585 -6 Left 996959584 5:129230956-129230978 CCTTAACGTAGTCGTGTTAATTG No data
Right 996959585 5:129230973-129230995 TAATTGTATACCTTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996959584 Original CRISPR CAATTAACACGACTACGTTA AGG (reversed) Intergenic