ID: 996961764

View in Genome Browser
Species Human (GRCh38)
Location 5:129259042-129259064
Sequence TTTATATTGTTCCCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996961764_996961765 -5 Left 996961764 5:129259042-129259064 CCTGGGCTTGGGAACAATATAAA No data
Right 996961765 5:129259060-129259082 ATAAATTGAGTTGAAATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996961764 Original CRISPR TTTATATTGTTCCCAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr