ID: 996964813

View in Genome Browser
Species Human (GRCh38)
Location 5:129295149-129295171
Sequence AGAGTTCCCAACTAAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996964813_996964814 1 Left 996964813 5:129295149-129295171 CCATGCTCTTAGTTGGGAACTCT No data
Right 996964814 5:129295173-129295195 AAGAGCAATAGTCTAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996964813 Original CRISPR AGAGTTCCCAACTAAGAGCA TGG (reversed) Intergenic
No off target data available for this crispr