ID: 996965701

View in Genome Browser
Species Human (GRCh38)
Location 5:129305325-129305347
Sequence TTGGAGTACCTGAAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996965701_996965706 19 Left 996965701 5:129305325-129305347 CCCGCCTCCTTCAGGTACTCCAA No data
Right 996965706 5:129305367-129305389 TTACGTATTTCCACATTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996965701 Original CRISPR TTGGAGTACCTGAAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr