ID: 996966248

View in Genome Browser
Species Human (GRCh38)
Location 5:129309488-129309510
Sequence AGGGGGATGGATTTTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996966239_996966248 7 Left 996966239 5:129309458-129309480 CCTCATTACTGGTATGTTAGTCA No data
Right 996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996966248 Original CRISPR AGGGGGATGGATTTTGAGGA GGG Intergenic
No off target data available for this crispr