ID: 996968968

View in Genome Browser
Species Human (GRCh38)
Location 5:129340431-129340453
Sequence ACAAAGAAACTCAACAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996968968_996968970 11 Left 996968968 5:129340431-129340453 CCATTCTTGTTGAGTTTCTTTGT No data
Right 996968970 5:129340465-129340487 ATTCAAAATCTGAGGTCTTATGG No data
996968968_996968969 3 Left 996968968 5:129340431-129340453 CCATTCTTGTTGAGTTTCTTTGT No data
Right 996968969 5:129340457-129340479 GAAGTGAAATTCAAAATCTGAGG No data
996968968_996968971 22 Left 996968968 5:129340431-129340453 CCATTCTTGTTGAGTTTCTTTGT No data
Right 996968971 5:129340476-129340498 GAGGTCTTATGGATATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996968968 Original CRISPR ACAAAGAAACTCAACAAGAA TGG (reversed) Intergenic
No off target data available for this crispr