ID: 996974520

View in Genome Browser
Species Human (GRCh38)
Location 5:129414495-129414517
Sequence CCATGAAGATATAAGAAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996974513_996974520 27 Left 996974513 5:129414445-129414467 CCCTGGCCTAGTACAGAGAATGT No data
Right 996974520 5:129414495-129414517 CCATGAAGATATAAGAAACGGGG No data
996974514_996974520 26 Left 996974514 5:129414446-129414468 CCTGGCCTAGTACAGAGAATGTA No data
Right 996974520 5:129414495-129414517 CCATGAAGATATAAGAAACGGGG No data
996974516_996974520 -7 Left 996974516 5:129414479-129414501 CCTGTGCTTAACTTCACCATGAA No data
Right 996974520 5:129414495-129414517 CCATGAAGATATAAGAAACGGGG No data
996974515_996974520 21 Left 996974515 5:129414451-129414473 CCTAGTACAGAGAATGTAAAGAT No data
Right 996974520 5:129414495-129414517 CCATGAAGATATAAGAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996974520 Original CRISPR CCATGAAGATATAAGAAACG GGG Intergenic
No off target data available for this crispr