ID: 996976022

View in Genome Browser
Species Human (GRCh38)
Location 5:129435752-129435774
Sequence CTCTGATGAAACCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996976022_996976025 4 Left 996976022 5:129435752-129435774 CCAAAATCAAGGTTTCATCAGAG No data
Right 996976025 5:129435779-129435801 GTTCCTTTCTGGAGGTTCAAAGG No data
996976022_996976026 5 Left 996976022 5:129435752-129435774 CCAAAATCAAGGTTTCATCAGAG No data
Right 996976026 5:129435780-129435802 TTCCTTTCTGGAGGTTCAAAGGG No data
996976022_996976023 -7 Left 996976022 5:129435752-129435774 CCAAAATCAAGGTTTCATCAGAG No data
Right 996976023 5:129435768-129435790 ATCAGAGCTCTGTTCCTTTCTGG No data
996976022_996976024 -4 Left 996976022 5:129435752-129435774 CCAAAATCAAGGTTTCATCAGAG No data
Right 996976024 5:129435771-129435793 AGAGCTCTGTTCCTTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996976022 Original CRISPR CTCTGATGAAACCTTGATTT TGG (reversed) Intergenic
No off target data available for this crispr