ID: 996976518

View in Genome Browser
Species Human (GRCh38)
Location 5:129440826-129440848
Sequence CCCTTTCAGCAGAAGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996976513_996976518 25 Left 996976513 5:129440778-129440800 CCTGGGGCAGTCTAATCATTCTA No data
Right 996976518 5:129440826-129440848 CCCTTTCAGCAGAAGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996976518 Original CRISPR CCCTTTCAGCAGAAGCAGAA TGG Intergenic
No off target data available for this crispr