ID: 996977131

View in Genome Browser
Species Human (GRCh38)
Location 5:129448435-129448457
Sequence AAGCGCGTGCTGAAACTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996977131_996977133 1 Left 996977131 5:129448435-129448457 CCCGTGAGTTTCAGCACGCGCTT No data
Right 996977133 5:129448459-129448481 AAGCTGATAACTTTGAAATTTGG No data
996977131_996977137 25 Left 996977131 5:129448435-129448457 CCCGTGAGTTTCAGCACGCGCTT No data
Right 996977137 5:129448483-129448505 CCTCTCATTGGCCTTTTGTAAGG No data
996977131_996977135 13 Left 996977131 5:129448435-129448457 CCCGTGAGTTTCAGCACGCGCTT No data
Right 996977135 5:129448471-129448493 TTGAAATTTGGGCCTCTCATTGG No data
996977131_996977134 2 Left 996977131 5:129448435-129448457 CCCGTGAGTTTCAGCACGCGCTT No data
Right 996977134 5:129448460-129448482 AGCTGATAACTTTGAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996977131 Original CRISPR AAGCGCGTGCTGAAACTCAC GGG (reversed) Intergenic
No off target data available for this crispr