ID: 996978280

View in Genome Browser
Species Human (GRCh38)
Location 5:129460327-129460349
Sequence CGCCCCGGAGTGGATCGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996978275_996978280 1 Left 996978275 5:129460303-129460325 CCTAGCGCTCCGGGGAGGCCGCT 0: 1
1: 0
2: 1
3: 10
4: 192
Right 996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
996978276_996978280 -8 Left 996978276 5:129460312-129460334 CCGGGGAGGCCGCTGCGCCCCGG 0: 1
1: 0
2: 3
3: 28
4: 319
Right 996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
996978267_996978280 12 Left 996978267 5:129460292-129460314 CCGCCCGGCCTCCTAGCGCTCCG 0: 1
1: 0
2: 0
3: 7
4: 165
Right 996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
996978266_996978280 26 Left 996978266 5:129460278-129460300 CCTGGGCAAATTCGCCGCCCGGC 0: 1
1: 0
2: 0
3: 6
4: 24
Right 996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
996978270_996978280 9 Left 996978270 5:129460295-129460317 CCCGGCCTCCTAGCGCTCCGGGG 0: 1
1: 0
2: 1
3: 17
4: 139
Right 996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
996978274_996978280 4 Left 996978274 5:129460300-129460322 CCTCCTAGCGCTCCGGGGAGGCC 0: 1
1: 0
2: 0
3: 11
4: 89
Right 996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
996978272_996978280 8 Left 996978272 5:129460296-129460318 CCGGCCTCCTAGCGCTCCGGGGA 0: 1
1: 0
2: 1
3: 9
4: 117
Right 996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996978280 Original CRISPR CGCCCCGGAGTGGATCGCGC TGG Exonic
900149518 1:1171950-1171972 CGCCCCGGCGTGGGTCGGGGAGG + Intergenic
900240714 1:1616046-1616068 CGCCCCCGAGCGGAGCGGGCGGG + Intronic
905033603 1:34903627-34903649 CTCCCGGGAGTGGATGGTGCAGG - Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
922730808 1:227948002-227948024 CGCCCGGGAGGGGATCACGCCGG + Intergenic
922925101 1:229342071-229342093 CGGCCCGGAGGGGAGCGCGAGGG - Intronic
1074772496 10:116742802-116742824 CGCCCCGCAGTCGACCGCGGCGG + Intergenic
1076935446 10:133565623-133565645 CGCGCAGGAGTGCATTGCGCAGG - Exonic
1083571505 11:63764173-63764195 CGCCCGGGAGTGGAGCGAGAAGG - Exonic
1094155578 12:27333625-27333647 TGCCCCGCGGTGGAGCGCGCAGG + Intronic
1099202467 12:79691336-79691358 CGCCCCGGAGTCGGAGGCGCCGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1131778340 15:95826789-95826811 CCCCCAGGAGTGGATGGCTCAGG + Intergenic
1132482219 16:172475-172497 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132483067 16:176279-176301 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1133295350 16:4749174-4749196 GGCCCCGGAGTGGAGGGGGCAGG - Exonic
1143890623 17:10099476-10099498 CGCCCTGGAGTGGTTCTGGCAGG + Intronic
1147723717 17:42553952-42553974 CGCCCCAGAGCGGCTCCCGCAGG - Intronic
1154202393 18:12308410-12308432 CGCCCCGGCGGGGGTCGCGCCGG - Intronic
1160992029 19:1863926-1863948 CGCGCTGGAGTGGGGCGCGCCGG - Intergenic
1161308099 19:3578300-3578322 TGCCCCCGAGTGGGTCCCGCCGG - Intronic
1162158840 19:8697351-8697373 TGCCCAGGAGTGGATGGGGCAGG + Intergenic
1164155634 19:22595584-22595606 CGCCCGGGACTGGATCTAGCTGG + Intergenic
1165736893 19:38182768-38182790 CGCCCTGGTGTGGATCTGGCGGG - Intronic
1168622261 19:57888880-57888902 GGCCCAGGAGTGGGTCACGCTGG + Exonic
937868843 2:126773291-126773313 TGCCCCGGAGTGGGTCAAGCAGG + Intergenic
942314242 2:174683063-174683085 CGGCCCGCAGAGGATCGCGGCGG + Intergenic
1170786987 20:19476101-19476123 GGCCTGGGAGTGGATCGCGTGGG - Intronic
1178493978 21:33071455-33071477 CTCCCCGGAGCGGAGCACGCCGG + Exonic
1180711390 22:17841943-17841965 CACCCCAGAGCGGATCGAGCTGG - Exonic
1184164707 22:42720567-42720589 CGCCCCGAAGTGGAGCGCGGCGG - Intronic
967316289 3:188154322-188154344 CACCCCGGAGGCGCTCGCGCCGG - Intronic
985591326 5:766943-766965 CTCCCCGGAGCTGATGGCGCAGG - Exonic
996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG + Exonic
1002524342 5:179806968-179806990 CGCCGCGGAGTCGACGGCGCAGG + Intronic
1018400537 6:163415360-163415382 CGCCCCGGCGGGGGTCGGGCCGG - Intronic
1022449832 7:30504533-30504555 GGCCCCGGCGTGGGTAGCGCGGG + Intronic
1060811264 9:126612669-126612691 CGCCCCGCAGCGGATCGCGGGGG + Intergenic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic