ID: 996978444

View in Genome Browser
Species Human (GRCh38)
Location 5:129461296-129461318
Sequence CCTTTGGAGGAGCCCGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996978432_996978444 30 Left 996978432 5:129461243-129461265 CCCGGGCGCAGGCTGCCGGCAGC 0: 1
1: 0
2: 1
3: 26
4: 332
Right 996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 158
996978435_996978444 15 Left 996978435 5:129461258-129461280 CCGGCAGCTCACGCGAGGTGCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 158
996978433_996978444 29 Left 996978433 5:129461244-129461266 CCGGGCGCAGGCTGCCGGCAGCT 0: 1
1: 0
2: 0
3: 15
4: 236
Right 996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996978444 Original CRISPR CCTTTGGAGGAGCCCGTGGA GGG Exonic
902534947 1:17114179-17114201 CCGTTGGATGGGCCTGTGGAAGG - Intronic
902884743 1:19396519-19396541 CTTTAGGAGGAGCCTGTGTAGGG - Intronic
903964001 1:27074690-27074712 CCCTTGGTGGGGCCTGTGGAGGG + Intergenic
905230509 1:36512304-36512326 CATTTGGAGCAGCCCGGGGCTGG + Intergenic
907249128 1:53126290-53126312 CCTGGGGAAGAGCCCTTGGAAGG + Intronic
912738697 1:112173849-112173871 CAGTTGGAGGAGCCCCAGGATGG + Intergenic
917308839 1:173656094-173656116 CATTGGGTGCAGCCCGTGGAGGG - Intronic
917678684 1:177344309-177344331 CATTTTGAGGAGTTCGTGGAGGG + Intergenic
920286748 1:204885167-204885189 CCTTTTGAGGAGCCCAGGGTGGG + Intronic
920313862 1:205064401-205064423 CCTTTGGAGCTGCCCGGGGCTGG - Exonic
922636093 1:227173173-227173195 CATTTGGAGGAGCCAATGCAGGG - Intronic
1063084835 10:2806965-2806987 CCGTGGAAGGAGACCGTGGAGGG + Intergenic
1063839467 10:10053372-10053394 CGTTTGGTGGAACACGTGGACGG - Intergenic
1067031320 10:42880104-42880126 CCCTTGCAGGAGCCCGTGGTGGG - Intergenic
1067095432 10:43296379-43296401 CCTGTGGAGGAGCCTGGGGCAGG - Intergenic
1067135090 10:43601067-43601089 CTTTAGGATGAGCCCATGGAAGG + Intergenic
1073681914 10:105714122-105714144 CCTTTGGTGGAGACTGAGGAAGG - Intergenic
1075099723 10:119497663-119497685 CCTTTGGAAGAGCCTGTTGTGGG - Intergenic
1075161449 10:120028051-120028073 CCATTGGAGGAGGCCTTGGGAGG + Intergenic
1077503406 11:2919385-2919407 CATCTGGAGGAGCCCGAAGAAGG - Exonic
1078090295 11:8260871-8260893 CCTTTGGGGGAGCCGGGGGGTGG + Intronic
1081806711 11:45894830-45894852 CCTTTGGAGCAGCCAGGGGGTGG + Intronic
1083278306 11:61610063-61610085 CCTTTTGAGGAAGCCATGGACGG + Intergenic
1089198787 11:116710973-116710995 CATATGGAGGAGCACATGGAAGG + Intergenic
1090428885 11:126629551-126629573 GATCTGGAGGAGCACGTGGAAGG - Intronic
1094103080 12:26784361-26784383 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1098211571 12:68171618-68171640 CATATGGAGGAGCTCATGGATGG + Intergenic
1099388997 12:82055309-82055331 TCTGTGGAGAGGCCCGTGGAGGG - Intergenic
1101933723 12:109038161-109038183 CCTTTGGAGGGGTCGGGGGAGGG - Intronic
1102484469 12:113246636-113246658 CTTCTGGAGGAGGCAGTGGAGGG + Intronic
1104482067 12:129116086-129116108 CCTCTGGAGGAGGCCCTGGCTGG - Intronic
1104977566 12:132559085-132559107 CCTTTGCAGGAAGCCGTGGCTGG + Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1114198930 14:20505324-20505346 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1114455107 14:22848985-22849007 CCAGTGGAGGAGCCTGGGGAGGG + Intronic
1114815563 14:25954074-25954096 GCTTTGGAGGAGCGAGGGGAGGG - Intergenic
1120584801 14:86299008-86299030 CATTTGGAAGAGGCCCTGGATGG + Intergenic
1120987151 14:90344109-90344131 GCTTTGGGGGAGACAGTGGATGG - Intergenic
1121558738 14:94858389-94858411 CTTTTGGAGGAGCTCAGGGAAGG + Intergenic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1125200496 15:37097815-37097837 CCTTAGGAAGGGACCGTGGAGGG - Intronic
1125966924 15:43882259-43882281 CCTTTGGAGCAGGCCGAGGTGGG - Intronic
1126048742 15:44668411-44668433 TCCTTGGAGGAGTTCGTGGAGGG + Exonic
1129280550 15:74481478-74481500 CCATTGGTGCTGCCCGTGGACGG + Intergenic
1129755335 15:78094637-78094659 CCTTTGGAGGAATGCCTGGAAGG + Intronic
1132234492 15:100208972-100208994 CCATTGGAAGAGCCCTTGGAAGG - Intronic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1132770326 16:1558649-1558671 CAGTTGGAGGGGCTCGTGGAGGG - Intronic
1133014046 16:2930715-2930737 CGAGTGGAGGAGCCCCTGGAGGG + Exonic
1134059656 16:11191449-11191471 CCTGGGGAGGGGCCCGAGGATGG - Intergenic
1136470193 16:30474422-30474444 CGTCTGGAGGAGCCTGTGGTGGG + Intronic
1136517576 16:30777252-30777274 CCCCTGGAGGAGCTCGGGGAAGG - Intergenic
1136571957 16:31103641-31103663 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1137456620 16:48622779-48622801 TCTTTGGGGAAGCCCGTGTAGGG + Intergenic
1138256876 16:55572710-55572732 CCTTTGGAGGATGAAGTGGAAGG + Intronic
1141732053 16:85829471-85829493 CCTTTGGAGGACTCCCGGGAGGG + Intergenic
1141741211 16:85894309-85894331 CCTTTCCAGGAGGCCCTGGAGGG + Intergenic
1142121759 16:88390017-88390039 CCTTGGGAGGAGGCTGTGCAAGG - Intergenic
1142599220 17:1045116-1045138 GCTTCGGAGGAGCCGGAGGAAGG + Intronic
1142818393 17:2446620-2446642 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1143671583 17:8399772-8399794 CCCTTGGAGATGCCAGTGGAAGG - Intergenic
1144206917 17:12985970-12985992 CTTTTGGAGAAGGACGTGGAGGG - Intronic
1144872103 17:18377940-18377962 CCTTTGGGGGACCCCTTGGCTGG - Exonic
1147160570 17:38567384-38567406 TCTTTGGAGGAGGCAGTTGAGGG - Intronic
1150220192 17:63491667-63491689 CCTTGGGAGCAGCCCCTGCATGG + Intronic
1150613754 17:66753371-66753393 CCAGTGGAGGAGTCAGTGGATGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151466214 17:74287143-74287165 CCTTTGGAGGCGCCCATGCATGG - Intronic
1151749185 17:76027122-76027144 CCTTTGGGGGACCCCTTGGCGGG + Exonic
1153834287 18:8950248-8950270 CCTGGGGAGGGGCCCGTGGGTGG - Intergenic
1153952303 18:10067693-10067715 CATTTGGAGGAACCCCGGGAAGG - Intergenic
1154128721 18:11717021-11717043 GCTTTGCAGGAGCCCATGGAGGG + Intronic
1157523372 18:48360747-48360769 AGTGTGGAGGAGCCCGAGGAAGG + Intronic
1158206632 18:55000468-55000490 CCTTAGAAGGAGCCCTAGGATGG - Intergenic
1158832070 18:61290575-61290597 CATTTGGAGGAGCCAGTGTAGGG - Intergenic
1160500561 18:79399647-79399669 TCTTTGGAGGTGCCCCTAGAAGG + Intronic
1160542572 18:79632903-79632925 CCTTAGAAGGAGCCCTAGGATGG + Intergenic
1160831425 19:1106442-1106464 CCCATGGAGGAGCCCCTGGTAGG + Exonic
1161713230 19:5861722-5861744 CAGTTGCAGGAGCCAGTGGAAGG - Intergenic
1164179237 19:22805690-22805712 CCTTTGGGCGAGCCAGTGGGTGG - Intergenic
1166808609 19:45501683-45501705 CCTTAGGAGGAGACCCTGAAAGG - Intronic
1167580418 19:50337993-50338015 CCTTTGCAGAAGCCCTCGGATGG + Intronic
925834045 2:7925677-7925699 CCTTTGGAGCAGCCTCAGGATGG + Intergenic
926861404 2:17313608-17313630 CGTTTGGAGGAGGGGGTGGATGG + Intergenic
929504073 2:42514628-42514650 CTTTGGGAGGAGCCCGAGGTGGG - Intronic
934088403 2:88529489-88529511 CCCTTGGAAGAGCCTTTGGAAGG - Exonic
936433202 2:112482059-112482081 GCTCTGGAGGAGCCCGTGGGCGG - Intergenic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
942761034 2:179398437-179398459 CCTTTGGAAGGGCGCCTGGAAGG + Intergenic
942865886 2:180674401-180674423 CCTGTGGATGATCCCTTGGAGGG + Intergenic
942944393 2:181657049-181657071 CCTTTGGAGAAGGAGGTGGAGGG + Intronic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948544407 2:238716830-238716852 CCAATGGAGGAGCCCCTGCAAGG + Intergenic
1171134295 20:22683245-22683267 CCTTTCAAGGAACCCCTGGAAGG + Intergenic
1172864269 20:38083630-38083652 CATTTGGAGTTTCCCGTGGATGG + Intronic
1175756682 20:61534753-61534775 CCTTTGGAGCAGCCTCTGGTGGG + Intronic
1175756699 20:61534833-61534855 CCTTTGGAGCAGCCTCTGGTGGG + Intronic
1175756716 20:61534913-61534935 CCTTTGGAGCAGCCTCTGGTGGG + Intronic
1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG + Intergenic
1179122453 21:38560441-38560463 CCTTTGGAGGGGCCCCGGGTTGG - Intronic
1179743449 21:43430471-43430493 CCATTTAAGCAGCCCGTGGAAGG - Intergenic
1180674933 22:17580706-17580728 CCTGCGGAGGAGCCAGAGGACGG + Intronic
1184130537 22:42514362-42514384 CTTTGGGAGGAGGGCGTGGAGGG - Intronic
1184140716 22:42576192-42576214 CTTTGGGAGGAGGGCGTGGAGGG - Intergenic
1185169602 22:49285153-49285175 ATTTCGGAGGAGCCTGTGGAGGG - Intergenic
949985025 3:9533805-9533827 CCTTTGGAGGAGTGACTGGAAGG + Intronic
952943733 3:38461803-38461825 CCTTTGGAGGGGGCCTCGGATGG - Intronic
954264047 3:49459728-49459750 CCTTTGGGGGAACCTCTGGAAGG - Intergenic
954324841 3:49857931-49857953 ACTGGGGAGGAGCCCCTGGAAGG - Intergenic
955331324 3:58049920-58049942 CTGTGGGAGGACCCCGTGGATGG + Intronic
955922108 3:63968025-63968047 GCTCTGGATGAGCCTGTGGACGG + Intronic
961677853 3:128578457-128578479 CCTGGGGAGGAGTCTGTGGAGGG - Intergenic
961742226 3:129040034-129040056 AATGTGGAGGAGCCCGAGGAAGG - Exonic
966807212 3:183817130-183817152 CCTCTTGAGAAGCCTGTGGAAGG - Exonic
966926179 3:184646022-184646044 CCTTTTGAGGCACCAGTGGAGGG + Intronic
968506987 4:975353-975375 CCGTGGAAGGAGACCGTGGAGGG - Intronic
969630376 4:8332514-8332536 ACTGTGCAGGAGCCCGTGAAGGG + Intergenic
969672364 4:8596826-8596848 GCTTTGGAGGAGCAGGTGCAGGG + Intronic
978761438 4:112358734-112358756 CACTCGGAGGAGCCCGTGGCTGG + Intronic
978789027 4:112641409-112641431 CCTTTGGAGGAGTTTGTGTAAGG + Intronic
980645311 4:135635905-135635927 CCTTGGGAGGAGCTCCTGGTGGG - Intergenic
984902311 4:184596194-184596216 CCTTGTGAGCAGCCCGTGTAGGG - Intergenic
984933855 4:184872633-184872655 TCTTTGGAGGAGTCCATGGAGGG - Intergenic
990512461 5:56501009-56501031 CCTTTGGAGAAGCCCTAGCAAGG - Intergenic
996978444 5:129461296-129461318 CCTTTGGAGGAGCCCGTGGAGGG + Exonic
998394948 5:141812275-141812297 GTTTTGGAGGAGCCCGGGGCAGG + Intergenic
1003567589 6:7233770-7233792 GCTTTGGAGAAGCTCGTGGAAGG + Intronic
1006679544 6:35787267-35787289 CTTCTGGGGGAGCCTGTGGACGG + Intronic
1008393811 6:50983846-50983868 CCTTGGGAGGATGCAGTGGAAGG + Intergenic
1010108976 6:72202321-72202343 CCTTTGGAGGAACCTGGGGAAGG + Intronic
1014202658 6:118622888-118622910 CCTTTAGAAGTGCCCATGGAAGG + Intronic
1017102757 6:150863228-150863250 CTTTGGGAGGAGGCCGAGGAGGG + Intergenic
1017696568 6:157021638-157021660 CCTTTGTGGGACCCCGCGGAAGG + Intronic
1018513909 6:164557109-164557131 CCTTTGAAGGGGCCCTTGCAGGG - Intergenic
1018879445 6:167862141-167862163 CCATTTTAGGAGTCCGTGGAAGG + Intronic
1018915586 6:168130625-168130647 CCTTGGCAGGTGCCGGTGGATGG - Intergenic
1019404045 7:873685-873707 CCTTTAGAAGAGCCAGTGCAAGG - Exonic
1019587429 7:1813110-1813132 CCTTTCGGGGAGCCCGGGGCCGG - Intergenic
1020514053 7:9093833-9093855 CCTTTGGGGGAGGCCGAGGCGGG + Intergenic
1024816807 7:53281003-53281025 CCTATGGAGGAGACAGGGGAAGG + Intergenic
1024996730 7:55278201-55278223 CATTTGGAGGAGCCCCAGGGAGG + Intergenic
1026037122 7:66837746-66837768 CCTGAGGAGAGGCCCGTGGAGGG - Intergenic
1029650294 7:101886764-101886786 CCTTTGGAGGAGGCTGGGCACGG + Intronic
1032403015 7:131637002-131637024 CCCATGGAGGAGCCTGAGGATGG + Intergenic
1033807294 7:144969393-144969415 CCTTTAAAGGAGCCACTGGAAGG - Intergenic
1035050787 7:155998087-155998109 GCTGTGCAGGAGCCCGTGGACGG + Intergenic
1036503735 8:9336526-9336548 CCTTGGGAGAAGCCCTTGGGAGG - Intergenic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1038450641 8:27636975-27636997 CCTCTGGAGGAGCACGGGAAGGG - Intronic
1039748672 8:40456672-40456694 GCTTATGCGGAGCCCGTGGAGGG - Intergenic
1039888640 8:41669906-41669928 CCTTTGAAGGAGACCGTGCCTGG - Intronic
1040898037 8:52389184-52389206 CCTTTGGAGGCGAGCGCGGAGGG + Intronic
1047873372 8:129109274-129109296 CTTTTGGAGGAGCATGTGGTTGG - Intergenic
1048005634 8:130417372-130417394 CCTTTGGAAGGGCCCCTGGAAGG - Intronic
1049297253 8:141848767-141848789 CCTCTGGAGGGGCCAGAGGATGG - Intergenic
1049521319 8:143092836-143092858 GCTGGGCAGGAGCCCGTGGAGGG - Intergenic
1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG + Intergenic
1056468994 9:86886820-86886842 CCTTTGGAGAGGCCTGTGTAGGG + Intergenic
1056510980 9:87305351-87305373 CCTCAGCAGGAGCCCGTGGGAGG - Intergenic
1056619610 9:88200661-88200683 ACTTTTTAGGAGCCCCTGGATGG - Intergenic
1056741197 9:89256827-89256849 CCTGTGGAGGAGCCTCTGGGAGG + Intergenic
1061518944 9:131106063-131106085 TCTGTTGAGGAGCCCGAGGAGGG - Intronic
1062713361 9:137988795-137988817 CCTTTGGAGGAGGCTGAGGAGGG + Intronic
1189322015 X:40092441-40092463 CCTCTGGAGGAGACCGTGGCGGG - Intronic
1189838239 X:45042237-45042259 CCGTGGAAGGAGACCGTGGAGGG + Intronic
1190163367 X:48050612-48050634 CATTTGGAAGAGCCAGTGTAGGG - Intronic
1190308503 X:49100697-49100719 CCTTTGGCGAAGCCTGTGTAAGG - Intronic
1195826141 X:109003495-109003517 CAGTTGGAGCAGCCCATGGAGGG + Intergenic
1196707540 X:118728534-118728556 CCTTAGGAGCAGCTCCTGGAAGG + Intronic
1196816341 X:119667843-119667865 CACTTGGAGGAGCCCTGGGAGGG - Intronic
1197283642 X:124567813-124567835 TCTTGGGAGGAGGCCGTGAAGGG - Intronic
1198219480 X:134586516-134586538 CCTTTGGATTAGGCCGTGAAAGG + Intronic