ID: 996980784

View in Genome Browser
Species Human (GRCh38)
Location 5:129491290-129491312
Sequence CACTCAGGAGTGGCCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996980784_996980788 11 Left 996980784 5:129491290-129491312 CCAGGCCGGGCCACTCCTGAGTG 0: 1
1: 0
2: 1
3: 18
4: 198
Right 996980788 5:129491324-129491346 TTATGCCACTGATAATGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996980784 Original CRISPR CACTCAGGAGTGGCCCGGCC TGG (reversed) Intronic
900148966 1:1170005-1170027 CTCACAGGTGTGGCCCTGCCTGG - Intergenic
900185305 1:1330609-1330631 CACGCAGGAGTGGCCCAGACGGG + Intergenic
901226001 1:7613392-7613414 CACACAGGAGAGGCCCAGCCTGG + Intronic
901631470 1:10650107-10650129 CCCTGAGGAGGGGCCGGGCCCGG - Intronic
901641182 1:10694007-10694029 CCCGCAGGAGCGGCCCGTCCCGG + Intronic
902222310 1:14974453-14974475 CACTCAGGAGTGGAGCAGCTGGG - Intronic
903969607 1:27110050-27110072 AACTCAGGAGTGGCAGAGCCAGG - Intronic
904376356 1:30084873-30084895 AACTCAGGAGGGACCCGGACCGG - Intergenic
904473267 1:30748690-30748712 CACTCCGCAGCAGCCCGGCCTGG + Intronic
904586625 1:31584386-31584408 CACAGAGAAGTGGCCAGGCCAGG - Intronic
905282709 1:36859403-36859425 CTCTGAGGAGTGGCCAGGCTTGG + Intronic
905344391 1:37301580-37301602 CAGTCAGGGGTGCACCGGCCAGG + Intergenic
905931792 1:41793066-41793088 CACACAGGAGTGGCCTGTCATGG + Intronic
907372766 1:54013896-54013918 CACCCCGGGGTGGCCAGGCCAGG + Intronic
908973420 1:69865839-69865861 ACCTCAGGAGTGACCTGGCCAGG + Intronic
910057885 1:83053372-83053394 CACACAGCAGTGGTCCAGCCTGG + Intergenic
911109039 1:94163775-94163797 CACTCAGTAGTGGCGTAGCCAGG + Intronic
915143428 1:153780510-153780532 GAATCAGGTGTGGCCGGGCCTGG + Intergenic
919098033 1:193059985-193060007 CCCTGAGGAATGGTCCGGCCGGG - Intronic
919536119 1:198790176-198790198 TACCCAAGAGTGGCCCGGACTGG + Intergenic
922533761 1:226364678-226364700 CACTCAGAGGTGGCCCGGCTGGG + Intronic
922768876 1:228171304-228171326 CTCACAGGAGAGCCCCGGCCTGG - Intronic
923077719 1:230624801-230624823 GACTCAGGAGTGGGCTGCCCAGG - Intergenic
1062989757 10:1804442-1804464 GAAACAGAAGTGGCCCGGCCTGG - Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1068615941 10:59116712-59116734 CTCTGAGGAGTGGCCAGGGCTGG - Intergenic
1069575852 10:69528097-69528119 CAATCAGGTGTGGAGCGGCCAGG + Intergenic
1069692677 10:70364135-70364157 CCCTCAGGACTCGCCAGGCCAGG + Intronic
1071531310 10:86392058-86392080 CCCTCAGAAGTGGCCCCTCCGGG - Intergenic
1071892346 10:90024303-90024325 CACTCCAGACTGGCCCAGCCTGG - Intergenic
1072443859 10:95480991-95481013 CACTCAGGAATGGCCCAGTAGGG + Intronic
1072699990 10:97633554-97633576 CACTCCGCATTGGCCCAGCCCGG + Intronic
1072810228 10:98455839-98455861 CACTCAGCAGGGGCCAGGCTGGG + Intergenic
1073070514 10:100790572-100790594 AACTCAGGAGTAGCAGGGCCCGG - Intronic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1075967833 10:126628146-126628168 AACACAGGAGTGACCCAGCCTGG - Intronic
1076813856 10:132904583-132904605 TACACAGCAGTGGCACGGCCAGG + Intronic
1077030255 11:462285-462307 CACTCAGGAGAGGCCAGTGCTGG - Intronic
1077183017 11:1224790-1224812 CACTCTGGCCTGGCCCTGCCTGG - Intronic
1077318552 11:1929842-1929864 CACTCAGCAGCGGGCCTGCCAGG - Intronic
1077356888 11:2122822-2122844 CACACAGGTGCGGCCAGGCCAGG - Intergenic
1077438310 11:2555564-2555586 CACACAGGAGTGGCCCAAGCCGG - Intronic
1077991681 11:7417650-7417672 AACTCAAGACTGGCCTGGCCAGG - Intronic
1078417042 11:11174425-11174447 AAATCAGGAGTGGCCGGGCAGGG - Intergenic
1078509255 11:11973509-11973531 CAAACAGGAGTGGCCAGGACTGG - Intronic
1080648099 11:34201839-34201861 CCCTGAGGAGTGGCTGGGCCAGG + Intronic
1081906836 11:46675577-46675599 CACTCAGCAGAGGCCCTGCCAGG + Intergenic
1082000488 11:47391360-47391382 CAATCAGGCCTGGCCTGGCCTGG - Intergenic
1082770291 11:57202536-57202558 CACCCAGGAGTGGCCAGAGCTGG + Intergenic
1083946438 11:65925687-65925709 AACCCAGGAGTGGACCTGCCAGG - Intergenic
1084150874 11:67287390-67287412 GACTCATGAGTGGCCCAGGCTGG + Intergenic
1084980915 11:72828300-72828322 CTGTCAGGAGTGGCCTGGCTAGG + Intronic
1085024285 11:73227737-73227759 CACAGAGGGGTGGCCCTGCCTGG - Intronic
1085353480 11:75815546-75815568 CACTCGGGAGGGACCCGGGCAGG + Intronic
1089069621 11:115689312-115689334 CAGGCAGGAGTGGCTCGGCAGGG + Intergenic
1089134576 11:116238880-116238902 CACTGAGGATGGGCCTGGCCAGG + Intergenic
1090398132 11:126432517-126432539 CACACAGGAGCTGCCCAGCCAGG + Intronic
1097138505 12:56879440-56879462 AACTCAGGAGTGCCTCTGCCCGG + Intergenic
1097167059 12:57091597-57091619 GACTCTGGAGTGCTCCGGCCTGG - Exonic
1099689903 12:85938927-85938949 CACTCAGCAGTGGCCCTAGCCGG - Intergenic
1100543225 12:95577604-95577626 CACTCTGGAGTTGCCCAGGCTGG - Intergenic
1101903944 12:108811664-108811686 CACCCAGGACAGGCCAGGCCGGG - Intronic
1102203585 12:111075036-111075058 CCCTCAGGTGTGACTCGGCCAGG - Intronic
1103324277 12:120110074-120110096 CACTCTGGAGGAGTCCGGCCTGG - Intronic
1104720591 12:131043161-131043183 CACCCTGGAGCAGCCCGGCCCGG + Intronic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1105852632 13:24349400-24349422 CAGTCAGCAGTGGCCGAGCCAGG + Intergenic
1106028668 13:25978649-25978671 GACTCAGGAGAGGCCGGGCGCGG + Intronic
1106290445 13:28356293-28356315 CCCTCAGGAATGGCCGTGCCGGG - Intronic
1107447192 13:40479865-40479887 CAGGCAGGAGTGGCCAGGCAAGG + Intergenic
1113439740 13:110319015-110319037 CACTCAGGAGAGGCCCTTCAAGG - Intronic
1113820513 13:113209462-113209484 CCCTCAGGAGTAGCCGGGCGCGG + Intronic
1114472836 14:22975568-22975590 GACTCAGGACTGGCCGGGCGCGG + Intronic
1115822116 14:37223789-37223811 CACCCAGGAGGGGCCAGGCAGGG - Intronic
1115850087 14:37584057-37584079 CCCGCCGGAGGGGCCCGGCCGGG - Intergenic
1120496231 14:85239975-85239997 CACTCAGGAGTGCCGGGGCATGG - Intergenic
1121271479 14:92640999-92641021 TACTCAGGAGTGGCGGGGCGGGG - Intronic
1122505493 14:102229225-102229247 CACCCAGGCCTGGCCCGGTCGGG + Exonic
1122902499 14:104787616-104787638 CTCTCAGGAGAAGCCTGGCCGGG - Intronic
1122940371 14:104978436-104978458 CGCTCCGCAGTGGCCCGGCAGGG - Intergenic
1124203247 15:27696555-27696577 CACGCAGGAAGGGACCGGCCAGG + Intergenic
1124713149 15:32031185-32031207 CACTCAGGAGAGGGCAGGCTGGG - Intronic
1127555051 15:60079813-60079835 CACTCAGAAGAGGCCGGGCGCGG + Intergenic
1129460367 15:75697333-75697355 CAGTCTGGAGGGCCCCGGCCTGG + Intronic
1131971038 15:97893082-97893104 CACTCTGGAGTGGTGGGGCCAGG - Intergenic
1132559391 16:586455-586477 TACTCAGGAGTGTCCCTGGCTGG + Intergenic
1132799893 16:1746845-1746867 CACTCGGGAGTGGTGAGGCCCGG + Intronic
1132926508 16:2432470-2432492 AACGCAGGAGTGTCCAGGCCAGG - Intronic
1135544108 16:23354338-23354360 CCCCCAGGAGTGGGCTGGCCGGG + Intronic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1139386536 16:66576104-66576126 AACTCAGGACTGGCCGGGCGCGG + Intronic
1139962563 16:70726294-70726316 CACCCACCAGCGGCCCGGCCCGG - Intronic
1140209699 16:72960373-72960395 CACACAGGGGTGGCATGGCCGGG + Intronic
1142823869 17:2495057-2495079 CATTCAGGATTGGCCAGGCATGG + Intronic
1145030466 17:19501245-19501267 CCCACAGGAGTGGCCCTGGCCGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149220154 17:54407897-54407919 AACTCAGTACAGGCCCGGCCTGG + Intergenic
1151475385 17:74342042-74342064 CACTCAGGAGGGGCCCTCCAGGG + Intronic
1152378784 17:79931547-79931569 CACTCATCTGTGGCCCAGCCAGG + Intergenic
1152929143 17:83101120-83101142 CACTCAAGAGTAGCCGGGCGGGG - Intergenic
1154011637 18:10579521-10579543 GACTCAGGAGTGGTGCTGCCTGG - Intergenic
1154099467 18:11456585-11456607 CACTGATGAATGGCCCGTCCTGG - Intergenic
1160092572 18:75840916-75840938 CACTCAGCAGTGGCACAGCCAGG - Intergenic
1160333313 18:78015096-78015118 CACTCAGGGCAGGGCCGGCCGGG - Intergenic
1161531487 19:4792556-4792578 CATCCAGGAGCAGCCCGGCCAGG + Exonic
1163556617 19:17997044-17997066 CACCCAGGACTGTCCCTGCCTGG + Intronic
1165084660 19:33335711-33335733 GACTCTGTTGTGGCCCGGCCAGG + Intergenic
1165709080 19:37996985-37997007 CACTGAGGATTGGCCGGGCACGG - Intronic
1167468287 19:49661867-49661889 AACTCAGGATTGGCCGGGCACGG - Intronic
925117130 2:1389126-1389148 CACTCAGGAGGGGCAGGGCCTGG + Intronic
928096695 2:28409277-28409299 CCATCAGGAGTGGCCCAGCCTGG + Intronic
931114762 2:59152648-59152670 CACACTGAAGTGGCCTGGCCAGG + Intergenic
936055416 2:109258596-109258618 CAGCCAGCTGTGGCCCGGCCTGG - Intronic
936081311 2:109434471-109434493 ACGTCAGGAGTTGCCCGGCCAGG - Intronic
936153936 2:110036227-110036249 CACTCATGAGTGGTCTGGGCAGG + Intergenic
936190749 2:110335188-110335210 CACTCATGAGTGGTCTGGGCAGG - Intergenic
936472474 2:112811472-112811494 CACTCAGGAATGGGCCTTCCTGG + Intergenic
937310886 2:120902677-120902699 CACCCAGGAGGGACCCGGCGAGG - Intronic
940035167 2:149305086-149305108 TATTCAGGAGTGCCCTGGCCTGG - Intergenic
946977052 2:225164653-225164675 CACTCAGGAGTGGCTCTCCAGGG + Intergenic
947623193 2:231604081-231604103 CACCCAGGGGTGGCCTGGCCTGG + Intergenic
948722999 2:239913058-239913080 CACTCAGCAGTGGCCCCGAGTGG - Intronic
1169092896 20:2872355-2872377 GACTCAGGGGTTGCCCGGTCTGG + Intronic
1171313673 20:24167094-24167116 CACTCAGCAGTAGCCCTGGCAGG + Intergenic
1172950921 20:38723125-38723147 TGCTCAGGAGGAGCCCGGCCAGG + Intergenic
1174363769 20:50044123-50044145 CTCTCAGCACTGGCCCAGCCTGG - Intergenic
1174452529 20:50628962-50628984 CACACAGGAGGGACCTGGCCTGG + Intronic
1175694809 20:61094047-61094069 CACTCTGATGTGGCCAGGCCTGG - Intergenic
1176099247 20:63357470-63357492 CACTCAGCACTGGCCTGGGCTGG + Intronic
1176168387 20:63686229-63686251 CCCTGAGGCTTGGCCCGGCCAGG - Intronic
1176383536 21:6125888-6125910 CACTCAGGAGTGCTCAGCCCTGG - Intergenic
1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1176832784 21:13763027-13763049 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1179739934 21:43412350-43412372 CACTCAGGAGTGCTCAGCCCTGG + Intergenic
1181438711 22:22924833-22924855 CCCCCAGGAGTGGCTCAGCCTGG - Intergenic
1182120654 22:27784244-27784266 CACTCAGGCCTGGCCTGGCCTGG - Intronic
1183525964 22:38322864-38322886 CAGGCAGCAGAGGCCCGGCCCGG - Intronic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184713520 22:46267619-46267641 CCCTCTGGACTGGCCCGGTCTGG - Intergenic
950704069 3:14769307-14769329 CACTCAGGAGGGGCTGGGGCAGG + Intronic
951541822 3:23789207-23789229 CACACAGGAGTGGCAGGGCAGGG + Intergenic
952536989 3:34321611-34321633 TACTAAGGATTGGCCCGGCATGG - Intergenic
954311469 3:49771921-49771943 TACTCAAGAGTGGCCAGGCGTGG + Intronic
957330248 3:78754320-78754342 CACTCAGGAGTAGCCTGGCAGGG + Intronic
960628309 3:119702914-119702936 AAAGCAGGAGTGGCCAGGCCAGG - Intergenic
963160716 3:142149014-142149036 CACTCACGGGTTACCCGGCCAGG + Intronic
966362802 3:179148454-179148476 CGCTCCGGAGCTGCCCGGCCGGG - Intronic
966775752 3:183541402-183541424 CACGCAGGAGTGCACAGGCCAGG + Intronic
968609054 4:1548927-1548949 CACGCAGGAGCGGCCGGGCCAGG - Intergenic
969226337 4:5800852-5800874 CACACAGGTGTGGCGCGGCGCGG - Intronic
969261040 4:6033941-6033963 GACTCAGGATGGGCCTGGCCTGG + Intronic
973543786 4:51959993-51960015 CCCTGAGGAGTGGCCAGGACAGG - Intergenic
977930277 4:102742917-102742939 CACTCAGCAGTGCCGTGGCCAGG + Intronic
979482914 4:121238798-121238820 AACTGAGGAGTGCCTCGGCCCGG + Intergenic
981485710 4:145284050-145284072 CAATTAGGAGTGGCAAGGCCCGG + Intergenic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985677759 5:1241055-1241077 GGCTCAGGAGGGGCGCGGCCTGG + Intronic
990003832 5:50922913-50922935 CACGCAGGAGCGGCCGGGCCAGG + Intergenic
990023042 5:51152074-51152096 TACTCAGGATTGGCCTGCCCAGG - Intergenic
992783884 5:80152203-80152225 CATTTAAGAGTGGCCCGGCTGGG + Intronic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
997689824 5:135820916-135820938 AAGTCAGGAGTGACCCAGCCGGG - Intergenic
998203936 5:140146028-140146050 CGCTCCGGAGAGGCCCGGCCAGG + Intergenic
1002955703 6:1861383-1861405 CACACTGGAGTGGCCCCTCCTGG - Intronic
1004232321 6:13844748-13844770 TACTCAGGGGCGGCCCGGCGCGG + Intergenic
1006114754 6:31769674-31769696 GACTCAGGAGCGGCGCTGCCGGG - Exonic
1008798431 6:55336232-55336254 GACAAAGAAGTGGCCCGGCCCGG - Intronic
1013155994 6:107491098-107491120 CTCTCCGGGGTGCCCCGGCCAGG - Intronic
1013296887 6:108765595-108765617 CACTCAAGTGTGGCCAGGCCTGG + Intergenic
1015922268 6:138278242-138278264 CGCTCAGGAGTGGATCTGCCTGG - Intronic
1016874002 6:148846947-148846969 CACTCAGGAGAGCCCATGCCTGG - Intronic
1019414885 7:922584-922606 CACTCAGGAGTGGACCCTCAGGG - Intronic
1019794323 7:3038637-3038659 CACTAAGGAATGGCCCCGGCTGG + Intronic
1021612434 7:22471301-22471323 CACTCAAGAGTTGCAAGGCCTGG + Intronic
1023755241 7:43409999-43410021 CACTCAGCAGCGGCACCGCCTGG - Intronic
1024641636 7:51333759-51333781 CACTCAGCAGCGGCCAGGGCCGG + Intergenic
1024739822 7:52341724-52341746 CACTGAGGAGTAGCGGGGCCTGG - Intergenic
1026167309 7:67921941-67921963 TAATCAGGAGTGTCCAGGCCCGG + Intergenic
1029174670 7:98656101-98656123 AACCCAGGAGTGTCCAGGCCTGG - Intergenic
1029257177 7:99277535-99277557 CATTCAGGAGTGGCTTGACCTGG - Intergenic
1035099819 7:156387659-156387681 AAATCAGCAGTGGCCCTGCCGGG + Intergenic
1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG + Intronic
1037902470 8:22695673-22695695 CACTCTGGAGGGGCCAGGTCTGG - Intergenic
1038450842 8:27637857-27637879 CACTCATGAGCGGCCAGGCTGGG + Intronic
1039389925 8:37171391-37171413 AGCTCAGGAGTTGCCCAGCCTGG + Intergenic
1039542235 8:38381989-38382011 CACTGAGGAGGGCCACGGCCGGG + Exonic
1040291427 8:46127543-46127565 CCCCCAGGTGTGTCCCGGCCTGG - Intergenic
1040291904 8:46129834-46129856 CACCCAGGGGTGTCCCGGGCAGG - Intergenic
1040308410 8:46224076-46224098 CACCCAGGGCTGTCCCGGCCTGG + Intergenic
1042518286 8:69682971-69682993 CACTCAGGATTGCCCCGGTGTGG + Intronic
1043516915 8:81003119-81003141 CACTCGGGGGTGGCGGGGCCCGG + Intronic
1049173052 8:141173993-141174015 AGCTCAGCAGTGGCCTGGCCAGG + Intronic
1049191055 8:141287853-141287875 CACACAGGAGGGCCCGGGCCAGG + Intronic
1049280040 8:141739683-141739705 CAGTCAGGGCTGGCCCAGCCTGG - Intergenic
1049342505 8:142120759-142120781 CACTCAGCAGCGGCCCCACCTGG + Intergenic
1049507115 8:143008702-143008724 CAAGCAGGCGTGGCCAGGCCGGG + Intergenic
1049773732 8:144395374-144395396 CACACACCAGTGGCCCGGCCAGG + Intronic
1050589079 9:7144261-7144283 AACTGAGGAGTGGCCGGGCATGG - Intergenic
1057474064 9:95384077-95384099 CAATCAGAAGTGGCCAGGACAGG - Intergenic
1057911839 9:99025729-99025751 CAGTCAGCAGTGACCCAGCCTGG + Intronic
1059345597 9:113625790-113625812 CACAGGGCAGTGGCCCGGCCAGG - Intergenic
1060725142 9:126001424-126001446 CACTCTGGAGAGGCTCTGCCCGG + Intergenic
1060813322 9:126622309-126622331 CTCACAGCACTGGCCCGGCCAGG - Intronic
1060901109 9:127259013-127259035 GACTCAGCAGTGGCTAGGCCTGG - Intronic
1061030624 9:128080073-128080095 AACTCAGGAGGGGCCGGGCATGG + Intronic
1061286894 9:129628835-129628857 CTCTCAGGAGCTCCCCGGCCAGG + Intronic
1061374057 9:130213867-130213889 CACTGAGGTGTGGCCAGGCATGG - Intronic
1061916496 9:133757890-133757912 GACTCAGGGGCGGCCCGGCGGGG - Intergenic
1062123142 9:134844995-134845017 CCCTCAGGAGTGGCCAAGGCTGG + Intergenic
1062504511 9:136866148-136866170 GACTGAGGAGCGGCCGGGCCGGG - Intronic
1062595747 9:137298418-137298440 CACTGCGGAGAGGCCTGGCCTGG - Intergenic
1190798033 X:53761826-53761848 CACTCAGGTGTGACCCTGACGGG + Intergenic
1190917125 X:54819383-54819405 CACTCAGGTGTGACCCTGACGGG - Intergenic
1192173277 X:68870156-68870178 CACACAGGAGTGGTCCAGGCAGG + Intergenic
1195936066 X:110126794-110126816 CACACAGGAGTGGCCCAGCCAGG - Intronic
1197228525 X:123978131-123978153 AACTCAGTAGTGGCCAGGCACGG - Intronic
1200240099 X:154488892-154488914 CTCTCAGCAGTGGCCTGGTCTGG - Exonic