ID: 996984288

View in Genome Browser
Species Human (GRCh38)
Location 5:129539871-129539893
Sequence CTGGAAACAAATATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 383}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996984288 Original CRISPR CTGGAAACAAATATGGAGAA AGG (reversed) Intronic
900905268 1:5552674-5552696 CTGGAAATAAAGGTGGAGAGGGG + Intergenic
902711638 1:18243927-18243949 ATAGACACAGATATGGAGAATGG - Intronic
903451439 1:23456195-23456217 CTGGAAGCAAATGTGGACAGAGG + Intronic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904899799 1:33847935-33847957 CTGGAAATCAAGATGAAGAATGG - Intronic
906976650 1:50581567-50581589 CTGGGAAGACATATGTAGAATGG + Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907483808 1:54762917-54762939 CTGGAGACTAATACGGAGACTGG - Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
908173215 1:61528554-61528576 ATGGAAGCAAATCAGGAGAAAGG - Intergenic
909652401 1:77990350-77990372 TTGGAGACAAATATTTAGAAAGG - Intronic
909950064 1:81708410-81708432 CTGGCAACAGATATGCATAATGG - Intronic
910335900 1:86131232-86131254 CTGGAAACATTTATCAAGAATGG - Intronic
910824678 1:91393223-91393245 ATGGAATAAATTATGGAGAATGG - Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911400146 1:97364380-97364402 GTAGCAACAAATAGGGAGAAAGG + Intronic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
912105198 1:106264794-106264816 CTGGAAACCGATGTGGAGAGGGG - Intergenic
912694953 1:111834418-111834440 ACTGAGACAAATATGGAGAATGG - Intronic
913360796 1:117978033-117978055 CTGGAAACAGATTTTGAAAATGG - Intronic
916318539 1:163477790-163477812 CTGGAAACTGATTTGGAAAATGG - Intergenic
916400094 1:164438218-164438240 CTAGAAACAAATAGAGACAATGG - Intergenic
918400631 1:184159172-184159194 CAGGAAACAACTATGAAGAAAGG - Intergenic
918563245 1:185894571-185894593 ATGGAAACAACTTTGGAAAAAGG - Intronic
919059901 1:192619239-192619261 ATGGAAATAAAGATTGAGAATGG - Intergenic
919503725 1:198371306-198371328 CTGGAAATAAATTTGGAAAAAGG + Intergenic
919744774 1:201001814-201001836 CTTGAAACAAATACTGAGAAAGG + Intronic
920775867 1:208936535-208936557 GTGGAAACAAAGATGTAGAGTGG - Intergenic
920955703 1:210618697-210618719 CTAGAAACATACATGGGGAAGGG - Intronic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
921413101 1:214857869-214857891 CTGGGAAAAAAAATGTAGAAAGG + Intergenic
922094644 1:222432629-222432651 CAGGAAAAAACTATGGAAAAGGG - Intergenic
923643021 1:235784818-235784840 CTGGAAACAAATTTGCTGATTGG + Intronic
923882714 1:238121354-238121376 CTCAAAACTACTATGGAGAAAGG + Intergenic
924168995 1:241317437-241317459 TTGGAGCCAAATATGGGGAAAGG + Intronic
924592932 1:245420836-245420858 CAGAACACAAATATGGGGAAGGG + Intronic
924817498 1:247455520-247455542 ATGCAAACAAATAAGGAGAAAGG - Intergenic
1062998014 10:1885687-1885709 CTGGAAAAGAATATGTAAAATGG - Intergenic
1063716222 10:8529786-8529808 CACGCAACAAGTATGGAGAAAGG + Intergenic
1064028441 10:11867865-11867887 CTGAAAACAAATGTGGCCAAGGG + Intronic
1064323270 10:14325909-14325931 CTGAAATCAAATATTTAGAATGG + Intronic
1064664187 10:17632812-17632834 GTGGAAACAAATACAAAGAAAGG + Intergenic
1065417102 10:25500319-25500341 CTGCAGATAAATATGGAAAAAGG + Intronic
1065772711 10:29092525-29092547 CTGGAATCAGATTTGGATAATGG + Intergenic
1066150707 10:32613613-32613635 TTGGAAACAAATGAGAAGAAAGG - Intronic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067321124 10:45222267-45222289 CAGTAAAGAAATATGGAGGAAGG + Intergenic
1068173868 10:53430917-53430939 CTGGAAACAAACAGGCAAAATGG - Intergenic
1068793577 10:61053260-61053282 CTGGACATAAAGATGAAGAATGG + Intergenic
1069956227 10:72053662-72053684 CTGGGAACAATGCTGGAGAAGGG + Intergenic
1070796138 10:79217697-79217719 CTGGAAACATACATGGAAAGAGG - Intronic
1071812600 10:89199825-89199847 CTGGAAACAAACACTGAGACAGG + Intergenic
1072350994 10:94556922-94556944 CAGGAAACACATCTGGAGACAGG - Intronic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1073605146 10:104887362-104887384 TTGGAAACAAATATGGATCTTGG + Intronic
1073758791 10:106608782-106608804 AAGGAAACAAACATGGACAAGGG + Intronic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074795345 10:116937771-116937793 CTGGAAAGTGATAGGGAGAATGG - Intronic
1076621822 10:131793870-131793892 CTGGAAAAAAAGGTGGAAAAGGG - Intergenic
1079918741 11:26404456-26404478 ATGGAATCAAATATAAAGAAAGG - Intronic
1080221146 11:29906081-29906103 CCTGAAACAGATAGGGAGAATGG + Intergenic
1080453014 11:32394193-32394215 CTGGATACAAATACAAAGAAAGG - Intronic
1082002918 11:47403581-47403603 CTGGAAAGAAGGATTGAGAAAGG + Intergenic
1083161630 11:60857973-60857995 CTGGAAACAAGGACTGAGAAGGG - Intergenic
1085975226 11:81644902-81644924 ATGGAAAAAAATAAGGAAAAGGG + Intergenic
1087153162 11:94876889-94876911 CTCCAGACAAATAAGGAGAAAGG + Intergenic
1087882192 11:103430267-103430289 CTGGAAACTGATGTAGAGAAAGG - Intronic
1088187244 11:107184549-107184571 CTACAGACAAATATGGAGATTGG + Intergenic
1088691524 11:112332699-112332721 CTGAAAACATATAAAGAGAAAGG - Intergenic
1088987521 11:114922895-114922917 CAGGAAACAAAGATGGAAAGTGG + Intergenic
1091082487 11:132683966-132683988 TTGGAGACAAATATTCAGAAAGG - Intronic
1092547792 12:9466823-9466845 CTGGGAATAAAGATGGAGAGAGG + Intergenic
1092908087 12:13120526-13120548 CTGGAAATAAGTATGTAGAATGG + Intronic
1093215500 12:16357016-16357038 AAGGAAGCAAATATGGGGAAAGG - Intronic
1094106902 12:26822627-26822649 ATGGAAACAAATACAGGGAAAGG + Intronic
1095318850 12:40800639-40800661 CTGGAAACAAAAAGTTAGAAAGG + Intronic
1098066620 12:66625136-66625158 CTGGGGACAGATTTGGAGAAAGG + Intronic
1098268285 12:68745938-68745960 CAGGAAACAAACATCAAGAAAGG + Intergenic
1098862343 12:75724197-75724219 ATGGAAACACATATGGGGAAAGG - Intergenic
1099170572 12:79359225-79359247 CTGGAAACCCATATGGTAAAGGG + Intronic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1099906093 12:88771991-88772013 CTGTAAATAAATATTGAAAATGG + Intergenic
1100129717 12:91476517-91476539 TTGGAAAAAAAAGTGGAGAAAGG - Intergenic
1102205227 12:111085733-111085755 CTGGAAACAAATGCTGGGAAGGG - Intronic
1102874227 12:116437214-116437236 CTGGACACACATTAGGAGAAAGG + Intergenic
1102945514 12:116984331-116984353 CTGGAAACCACCCTGGAGAAAGG + Intronic
1103245656 12:119454883-119454905 ATGGAAGCAAATACGGAGGATGG - Intronic
1104013675 12:124948987-124949009 CTGGGCACAAATCTGGAGGAAGG - Intronic
1104126960 12:125856822-125856844 CTAGAAACAAGGATGGACAAAGG + Intergenic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1107051309 13:36053410-36053432 CTGGAAATAGCCATGGAGAAAGG + Intronic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108292217 13:48973366-48973388 GCTGCAACAAATATGGAGAATGG + Intergenic
1108524080 13:51271059-51271081 CTGGAAAATGATATGGATAATGG - Intronic
1108830233 13:54468660-54468682 ATGGAGGCATATATGGAGAAAGG + Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1110687886 13:78396568-78396590 TTGGAAACAAATATATAAAATGG - Intergenic
1110864585 13:80380045-80380067 TTGGAACCCAGTATGGAGAAAGG + Intergenic
1111104914 13:83632277-83632299 CTAGAAATAAAGAAGGAGAATGG + Intergenic
1111528000 13:89497586-89497608 CAGGAAACAAATAGGGCAAAGGG + Intergenic
1112217777 13:97452222-97452244 CTAGAAGTAAATATGCAGAATGG - Intronic
1112498503 13:99924339-99924361 CTGGAAACAGATAGTGAGGATGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112809767 13:103204144-103204166 CTGGAAACAAAATAGGAGATGGG - Intergenic
1113850731 13:113416233-113416255 CTGGAAATAAATCTGGCTAATGG + Intergenic
1115156860 14:30350747-30350769 GTGGACACAAATATGGGGATGGG + Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116368491 14:44100589-44100611 CTAGAAAAAAGTATGGATAAGGG - Intergenic
1118851209 14:69585117-69585139 CTGGAGGCAAATTTTGAGAAGGG + Intergenic
1118902534 14:69998843-69998865 CTGGAAAAAAACAGGGACAAAGG - Intronic
1120079418 14:80198662-80198684 CTGGAAGCATATATGAAGAGTGG + Intronic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1120214146 14:81663820-81663842 ATGGAAACAAATTCAGAGAAAGG + Intergenic
1120379297 14:83753909-83753931 CAGGAAACAAATTTGAAAAAAGG - Intergenic
1121606164 14:95241578-95241600 CTGGAAACTATGATGAAGAAAGG + Intronic
1122369829 14:101223351-101223373 TTGCACAGAAATATGGAGAATGG + Intergenic
1124025830 15:25964728-25964750 AAGAAAACAAATGTGGAGAAGGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125437612 15:39664410-39664432 CTGTAAATAAATATGATGAATGG - Intronic
1125824666 15:42666227-42666249 TTGGAAACACATTTAGAGAATGG + Intronic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1127276371 15:57448670-57448692 ATAGAAACAATTATGGACAAAGG - Intronic
1128019369 15:64376883-64376905 CTGAAAATAAATATGCAGGAGGG - Exonic
1128219467 15:65958028-65958050 ATGGAAACCAAAATGGAGAGTGG + Intronic
1128444059 15:67741180-67741202 ATGGAAACAAATTCAGAGAAAGG + Intronic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1131454651 15:92573873-92573895 CTGGAAACAAATATGTTGCGTGG + Intergenic
1131551588 15:93361998-93362020 CTGGAAATAAACATGGGGGAGGG - Intergenic
1131739187 15:95368912-95368934 ATGGAAACAAAAATGGTTAAAGG - Intergenic
1133099593 16:3471087-3471109 CTGGAAACAAATGAGGATACTGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134034594 16:11020170-11020192 CTGGAAGCCAAAATGGAGACTGG - Intronic
1134345765 16:13389932-13389954 GTGGAAAAAAGAATGGAGAATGG - Intergenic
1134654247 16:15935724-15935746 AGGGAAACAAATATGAACAAAGG + Intergenic
1135007589 16:18840841-18840863 CTTGAGACAAATTTGGAGAGGGG - Intronic
1135385082 16:22031954-22031976 CTGGTAACAGAAATGGAAAATGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1135828370 16:25750824-25750846 CTGGAAAGAAAGAAGTAGAAGGG - Intronic
1135943163 16:26840508-26840530 AAAGAAAGAAATATGGAGAAAGG + Intergenic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1138603893 16:58074860-58074882 CTGGAAACAAATATGGATTTCGG + Intergenic
1138845846 16:60564767-60564789 CTGGGAATAAATATGGAGGAGGG + Intergenic
1139125643 16:64073058-64073080 CTCTAAACAAAGGTGGAGAAAGG - Intergenic
1141229474 16:82151842-82151864 TTGGAAAAAAATATGGTGAGGGG - Intronic
1141399692 16:83736699-83736721 CTGGAAATAAATCTGCAAAATGG + Intronic
1143009981 17:3860916-3860938 CTGGAAACATGGATGGACAAGGG - Intronic
1143238811 17:5426384-5426406 CTGGGAAGAAATATGCACAATGG - Intronic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1144004271 17:11085994-11086016 CTGAAAAGGAATCTGGAGAATGG + Intergenic
1144526101 17:15991477-15991499 GTTGACACAAATATGGGGAAAGG - Intronic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1146972988 17:37087440-37087462 CTGGAAAGGAAGATTGAGAATGG + Intronic
1148219159 17:45849993-45850015 CAGGAAACAAGTGTGGAGACGGG + Intergenic
1148987129 17:51632744-51632766 GTGGAAAGAAAGATGGAGGAAGG - Intronic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149334004 17:55616775-55616797 TTGGAAGCAGATATGGAAAAAGG + Intergenic
1150690800 17:67365648-67365670 CAAGAAACAAGGATGGAGAAAGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154062697 18:11077950-11077972 CTGGAAACAGCAATGGAAAAAGG + Intronic
1155103084 18:22633203-22633225 CTAGACAAAAATATGGGGAAAGG - Intergenic
1156070753 18:33204938-33204960 CAGGAAACAAGGAGGGAGAAAGG + Intronic
1156999606 18:43509224-43509246 CTGTAAACAAAAATGTAGACTGG - Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1158779739 18:60633029-60633051 CTGTATACAAATAGGCAGAATGG + Intergenic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1159909623 18:74133336-74133358 CTGGAATCAGATTTGGAGCATGG - Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1164123435 19:22288412-22288434 CAGGAAAAAAATCTGAAGAATGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1167639753 19:50674335-50674357 CTGGTCTCAAAGATGGAGAAGGG - Intronic
927248487 2:20977587-20977609 TTGGAAACAAAAATGAAAAATGG + Intergenic
927367277 2:22313053-22313075 CTGGAAACAAATATAGTCCAAGG - Intergenic
931552544 2:63462637-63462659 CTGGCTAAAAATATGCAGAAAGG + Intronic
932868566 2:75373493-75373515 CTGGAAAGCAATGGGGAGAATGG - Intergenic
934940620 2:98499158-98499180 CAGCAAACATATATGAAGAAGGG - Intronic
936415615 2:112307330-112307352 CTGGAAACAAATAAAGGAAAAGG - Intronic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
937831413 2:126428568-126428590 CTGAAAACAGATGTAGAGAAGGG + Intergenic
939367290 2:141249990-141250012 CTGTAAATAATTCTGGAGAAAGG + Intronic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
940316327 2:152331133-152331155 ATGACAAGAAATATGGAGAAAGG - Intergenic
940776494 2:157889954-157889976 ATGTAAACAAATATGGAAGAAGG - Intronic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942376920 2:175347063-175347085 CTGGAAAGAAATTTGGTAAAAGG + Intergenic
942432509 2:175927878-175927900 TTTGAAAGAAATATGGAGGAAGG - Exonic
943606523 2:189983558-189983580 CTGGGAACAGATGTGGGGAAGGG - Intronic
943763892 2:191639475-191639497 CTGGAATCATACATGGAGGATGG + Intergenic
943832659 2:192482978-192483000 ATGCTGACAAATATGGAGAATGG + Intergenic
944868200 2:203882841-203882863 CTGGAAAAAAAAATAGTGAATGG + Intergenic
945536995 2:211029298-211029320 TTAAAAACAAATATGGAGTATGG + Intergenic
946295814 2:218782573-218782595 CTGGAAATCAGTAGGGAGAATGG + Intronic
946441415 2:219700067-219700089 CTTGAATCAAACATGGAAAAGGG + Intergenic
947516581 2:230810655-230810677 CTGCATACAAATAGAGAGAAAGG + Intronic
1169974476 20:11307959-11307981 CAGGAAAAAAATATGGACTAAGG + Intergenic
1170281661 20:14655959-14655981 CTGGAAATAGAAATGAAGAAAGG + Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1171053281 20:21881874-21881896 CTTGAAAGAAATGAGGAGAATGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172370538 20:34386865-34386887 GTGGAAACAAAAATGTGGAAAGG - Intronic
1173131204 20:40395403-40395425 CTGGAAACAAATCCTGAGAAGGG + Intergenic
1173932070 20:46829176-46829198 CTGGAAGGATATATGGAAAACGG + Intergenic
1174701523 20:52614042-52614064 CTGGTTATAAATATGCAGAATGG + Intergenic
1174744257 20:53045951-53045973 CAGGAAACAGATACAGAGAAAGG - Intronic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1175478141 20:59291562-59291584 CTGGTAACATATATGCAGTACGG + Intergenic
1175818860 20:61897761-61897783 CTGGAACCAAGGATGGACAATGG - Intronic
1178686803 21:34718274-34718296 CTTGAAACCTAAATGGAGAATGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1184603870 22:45560700-45560722 ATAGAAACTAATCTGGAGAACGG - Intronic
949139089 3:610431-610453 CAGGAATCAGAAATGGAGAAAGG - Intergenic
950214567 3:11150339-11150361 CAGGAAACAAATCAAGAGAAGGG + Intronic
950219954 3:11186967-11186989 CTGGAATTAATTCTGGAGAAAGG - Intronic
950326916 3:12119642-12119664 CTGGAAAGAATTATGGAATATGG - Intronic
950748253 3:15108040-15108062 GGGGAAACAACTTTGGAGAAAGG - Intergenic
950938153 3:16864355-16864377 CTGGAAACGAAAAGGGAAAATGG - Intronic
951880476 3:27476726-27476748 CAGGAAACAAATATGGTGGAAGG - Intronic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
955548280 3:60055677-60055699 CTGGAAACCAACATGTTGAAGGG + Intronic
957651543 3:83012831-83012853 ATGGAAAGAAAAAGGGAGAAAGG - Intergenic
957890187 3:86346598-86346620 CAGAAAACTAAAATGGAGAAAGG + Intergenic
959351185 3:105266318-105266340 CAGGAAAAAATTATGGAGAATGG + Intergenic
959760351 3:109955760-109955782 CTATAAACAAATGTGGAGAAAGG - Intergenic
959969519 3:112393591-112393613 GTCTAAAAAAATATGGAGAAAGG - Intergenic
960440892 3:117687285-117687307 TTGGAAAAAGATTTGGAGAATGG - Intergenic
960549977 3:118964517-118964539 CAGGAAAAAAGCATGGAGAAGGG + Intronic
960822770 3:121751872-121751894 GTGGAAATAAGTATGTAGAAAGG - Intergenic
961259965 3:125594607-125594629 CGGGAAATAATTTTGGAGAAAGG + Intronic
962347395 3:134628205-134628227 ATGGAAACAAAGATGCAGGAAGG + Intronic
962421359 3:135231942-135231964 CTGGAAAGAAATAAGCAGCAGGG + Intronic
963179754 3:142341742-142341764 ATGGAAACCAAAATGGAGCAGGG + Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963492924 3:146023563-146023585 CTGGAAAGAAATCTGAAGACGGG + Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964026126 3:152077222-152077244 ATAGAAACAGACATGGAGAAGGG - Intergenic
964346966 3:155763684-155763706 CTGGAGAGAAATATGGAAAAAGG - Exonic
964508099 3:157421577-157421599 ATGGAAGGAAATGTGGAGAAAGG - Intronic
964684476 3:159379814-159379836 CTGAGAAGAAATATGGAGAGAGG + Intronic
964821322 3:160773460-160773482 CTAGAAATAAGTATGGAGAGAGG + Intronic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965727467 3:171733914-171733936 CAGGAAACAAAGGTGGAGAAAGG + Intronic
966345287 3:178972594-178972616 CTGGAAACAAATATTTATCAAGG + Intergenic
966383517 3:179368574-179368596 TTGGCACAAAATATGGAGAATGG - Intronic
966625294 3:182009239-182009261 CTGGAAACATAAAAGGAAAAAGG + Intergenic
967776226 3:193388810-193388832 GTGGTTACAAAGATGGAGAATGG + Intergenic
969420538 4:7092155-7092177 CTGGAAAGAAATTTAGAGACAGG - Intergenic
971963397 4:33518636-33518658 CTGGAAGCTAATCTGGAGAAAGG - Intergenic
972198850 4:36688014-36688036 CTGGCAGCAAATATGAAAAAAGG - Intergenic
972583672 4:40417373-40417395 CAGGAAAAAAAAATGTAGAAAGG + Intergenic
973085667 4:46056259-46056281 CAGAAAATAAATTTGGAGAAGGG - Intronic
974339372 4:60594510-60594532 CAGGAAACAAGGAAGGAGAAGGG - Intergenic
974622121 4:64370078-64370100 ATGTGAACAAACATGGAGAAAGG + Intronic
977787580 4:101056573-101056595 ATGGAATGAAATATTGAGAAGGG + Intronic
978052087 4:104213752-104213774 GTGGAATAAAATATTGAGAATGG + Intergenic
979478870 4:121190720-121190742 CTCGAAATAAATATGAATAAGGG + Intronic
980504865 4:133705451-133705473 ATGAAAACAAAAATGTAGAAGGG - Intergenic
982669202 4:158299762-158299784 CAGGAAATAAATATGTAGAGAGG - Intergenic
983330653 4:166323744-166323766 CAGGATACATATATGTAGAATGG - Intergenic
983537355 4:168872353-168872375 CTGAACACAATTATGGAGGAGGG - Intronic
983598063 4:169492914-169492936 CTCGGAACAAACGTGGAGAAGGG + Intronic
983666438 4:170189444-170189466 CTAGAAACAAAGAAGGAAAAGGG - Intergenic
984079513 4:175228382-175228404 TGGGGAACAAATGTGGAGAAAGG + Intergenic
985364746 4:189216503-189216525 GTGCAAACAATCATGGAGAAAGG + Intergenic
987682288 5:21153066-21153088 CTTGATACAAATATGGAAAATGG + Intergenic
987954060 5:24715056-24715078 CTGGAAAGAAATCGGTAGAAAGG - Intergenic
988409694 5:30871309-30871331 TTTGAGACAAATTTGGAGAAAGG + Intergenic
988715936 5:33828372-33828394 CTGGAAATAAATAAGAAGATGGG - Intronic
989095791 5:37780076-37780098 GTGGAAATAAATATGGATACTGG - Intergenic
989552921 5:42756940-42756962 CTGTAATGAAATATGAAGAAAGG - Intronic
990736611 5:58870745-58870767 CAGGAAACAAAAATGGTGTAAGG - Intergenic
991236438 5:64404796-64404818 ATGGAAGTAAATGTGGAGAAAGG - Intergenic
993059770 5:83025288-83025310 TTGGAAAAAAATATTGAAAATGG - Intergenic
993193796 5:84713691-84713713 CTTGAAACAAAGATTGAGACTGG - Intergenic
993445622 5:88008880-88008902 CAGCATACAAATTTGGAGAAGGG + Intergenic
993509644 5:88755616-88755638 CTCTAAGCAAATATGGAAAAGGG - Intronic
993604360 5:89970085-89970107 AAGGAATCAAAGATGGAGAATGG + Intergenic
994631087 5:102288727-102288749 CTGGAGAAAAATATGGTTAAGGG - Intronic
994673097 5:102785805-102785827 TTGGAAACAAATGGGGAGTAAGG + Intronic
995405114 5:111785951-111785973 CTGGAAAGAAAAATGAAGAGAGG + Intronic
996261430 5:121474661-121474683 ATAGAAATAATTATGGAGAATGG + Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
999551723 5:152694886-152694908 CTTTTAACAAAAATGGAGAAGGG - Intergenic
999785333 5:154885058-154885080 CTGCAAACAAAAATGTAGACTGG + Intergenic
1000209093 5:159095127-159095149 TTGAAAACAAATCTGCAGAATGG + Intronic
1000810847 5:165858918-165858940 CAGGAAACAGTCATGGAGAAAGG + Intergenic
1001584755 5:172826271-172826293 CTGGCAGCCAATGTGGAGAAGGG - Intergenic
1003797292 6:9619059-9619081 CTGGCTACAAATATGAACAATGG + Intronic
1004301894 6:14466127-14466149 CTTGAAAGAAATAATGAGAAGGG + Intergenic
1006532430 6:34667937-34667959 CTGGGAACAAATTTAGAGATGGG + Intronic
1007057392 6:38901043-38901065 ATTGAAAAAAAAATGGAGAAAGG - Intronic
1007988705 6:46232999-46233021 CAGCAAAAAAATATGTAGAATGG - Intronic
1008693091 6:54002829-54002851 CTGATTACAGATATGGAGAATGG + Intronic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1010130537 6:72487637-72487659 TTGGAAACAACTATTGAGCAGGG - Intergenic
1010534995 6:77015352-77015374 ATGGAAACAAATAATTAGAATGG - Intergenic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1010957881 6:82111731-82111753 ATGGAAAACAGTATGGAGAATGG + Intergenic
1011000732 6:82585176-82585198 CTGAAGACAAAAATAGAGAAAGG + Intergenic
1012177881 6:96111351-96111373 TTGGACACAAATATAGGGAATGG + Intronic
1012320601 6:97840114-97840136 GTGGAAACTAAGATTGAGAACGG + Intergenic
1012551559 6:100468122-100468144 CTGCAAAAAAATAAAGAGAATGG - Intergenic
1012642832 6:101642387-101642409 ATGGAAAGAGAAATGGAGAATGG - Intronic
1012665309 6:101961519-101961541 CTGGGAACAAAGATGGATAGGGG - Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1015051208 6:128842545-128842567 CTGGAATCAATCATGGAGGAAGG + Intergenic
1015075809 6:129155924-129155946 CTATATACAAATATGGAAAATGG + Intronic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016375705 6:143418463-143418485 AGGGAAACAAAAAAGGAGAAGGG + Intergenic
1016505669 6:144776260-144776282 CTGGGAAAAAATGTGGAGACGGG - Intronic
1016670157 6:146695273-146695295 TTACAAACAAATTTGGAGAAGGG - Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017528900 6:155267985-155268007 TTGAAAACAAATTTGTAGAAGGG - Intronic
1020483549 7:8692389-8692411 CTGGAGAGAAATAGGCAGAATGG + Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021249526 7:18306883-18306905 TTGGAAACAGACATGGAGAATGG - Intronic
1023297810 7:38734545-38734567 CTGCAGAGAAATAAGGAGAAAGG - Intronic
1023519807 7:41039013-41039035 CGGAAAACAAATAAAGAGAAGGG - Intergenic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1027618837 7:80457596-80457618 CTGGAATAAAATGTGGGGAATGG + Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1028631522 7:92939838-92939860 CCAGAGACACATATGGAGAAAGG - Intergenic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1029606383 7:101601733-101601755 CTTTGAACAAATGTGGAGAAAGG + Intergenic
1030963504 7:115957855-115957877 CAGGAAGTAAATATGAAGAAAGG + Intronic
1031037130 7:116799734-116799756 CTTTAAAGAAATAGGGAGAAGGG + Intergenic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1031971590 7:128068649-128068671 CTGAAATCAAACATGGAGGAAGG - Intronic
1032524975 7:132573187-132573209 CTGGACACAAATAAGAAGAGAGG + Intronic
1032686008 7:134234476-134234498 TTGGAAACAACAATGAAGAAAGG - Intronic
1033434846 7:141323871-141323893 ATGGAAACAGATTTTGAGAAGGG + Intronic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1037945401 8:22986595-22986617 CTGGATAGAATTCTGGAGAAGGG - Intronic
1037968198 8:23150033-23150055 CTGGAAACACATAGAGATAAGGG + Intronic
1037980237 8:23247964-23247986 CTGGGAACAAAAGTAGAGAAGGG - Intronic
1038086795 8:24206906-24206928 GGGGAAACAAACATGGAAAAGGG - Intergenic
1039089395 8:33812430-33812452 CTGAAAAGAAATATAGAAAAGGG - Intergenic
1039409249 8:37338672-37338694 ATAGAAACAAAGAAGGAGAAAGG - Intergenic
1040029698 8:42813467-42813489 CTGGAAACTCACAGGGAGAAAGG + Intergenic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1040889924 8:52306480-52306502 ATGAAAACAAATATTGTGAAGGG + Intronic
1041015287 8:53587105-53587127 GTGAAAAGAAGTATGGAGAATGG + Intergenic
1041552522 8:59118429-59118451 CTGGCAACTAATCCGGAGAAGGG + Intronic
1041730867 8:61061472-61061494 CCGGAAACAGAGGTGGAGAAGGG - Intronic
1042281801 8:67064070-67064092 CTGGAAAGAAAAATGGGGAGGGG - Intronic
1043044639 8:75306306-75306328 CAGGGAACAAATAGGGTGAAAGG - Intergenic
1044200912 8:89435006-89435028 CTGTAAACAAAGATGTCGAAAGG + Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045796885 8:106056865-106056887 CGGGGAACAAATTTGGAGAACGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046974877 8:120263214-120263236 TGTGAAACATATATGGAGAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048662406 8:136619502-136619524 CTTGAAATAAATATTGTGAAAGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1050175061 9:2861264-2861286 CTGGAAAGAAATAGGCAGCATGG + Intergenic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050337262 9:4601660-4601682 AGTGAAACAGATATGGAGAAGGG + Intronic
1051152723 9:14101437-14101459 CTGTGAACCAATATGGAGATAGG + Intronic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1053031039 9:34777991-34778013 CTAGAAACCAATGTGGGGAAAGG - Intergenic
1055229206 9:74041266-74041288 TTCAAAACAAATGTGGAGAATGG - Intergenic
1055361609 9:75497014-75497036 CTGGAAAGAAATATGGGTCAAGG - Intergenic
1056101026 9:83301002-83301024 CTGGACACAAATATTAAGCAGGG + Intronic
1056317859 9:85408716-85408738 CTGGTAACAAACATGGACGAGGG + Intergenic
1056342976 9:85656162-85656184 CTGGTATCTAATCTGGAGAAGGG + Intronic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1058175306 9:101729097-101729119 CTGGAGAAAAATGTCGAGAAAGG - Intronic
1058407060 9:104688644-104688666 TTGGAAAGAAAATTGGAGAAAGG - Intergenic
1058823259 9:108752477-108752499 AAGAAAACAAACATGGAGAAAGG + Intergenic
1058877033 9:109253198-109253220 ATGGAAAGAAATATGGAGAAAGG + Intronic
1059874020 9:118612675-118612697 GTGGAAACAAATATGAGGAATGG - Intergenic
1060623397 9:125088487-125088509 CAGGAAACAATCCTGGAGAAAGG - Intronic
1062241776 9:135544809-135544831 CAGGCAACAAAAATGGGGAACGG + Intergenic
1203618258 Un_KI270749v1:89889-89911 CAGGAATCAGAAATGGAGAAAGG + Intergenic
1185818064 X:3174759-3174781 CAGGAAAGAAATATGGACAGTGG + Intergenic
1186898762 X:14031525-14031547 CAGGAAAGAAAGATGGAGAGGGG + Intergenic
1187235700 X:17465017-17465039 CTGGGAAGAAAGATGTAGAACGG + Intronic
1187533215 X:20115216-20115238 ATGGAAACAAAATTGGGGAAGGG - Intronic
1187748202 X:22432463-22432485 CTGGAAGCAGATATGGCGAGAGG - Intergenic
1188290414 X:28381038-28381060 CTGGAATCATATATTGAAAAAGG + Intergenic
1188314554 X:28657329-28657351 CTGGAAAAAAATGTGGAAAATGG - Intronic
1188492224 X:30749775-30749797 ATTGAAACCAATATGGCGAAGGG - Intergenic
1189046591 X:37599099-37599121 CTAGTAACAAATTTGCAGAATGG - Intronic
1190053220 X:47167161-47167183 CTAGGAAAAAATATGGGGAAAGG - Intronic
1190176489 X:48155096-48155118 CTGGAAAGAAAAAAAGAGAAAGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192719890 X:73683127-73683149 CATGAAACAATTATTGAGAATGG + Exonic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1192834132 X:74781245-74781267 CTGGAAATGAATATTGAGAGAGG + Intronic
1192888044 X:75357961-75357983 CTGGTAAGAAGTAGGGAGAAGGG + Intergenic
1193552292 X:82910637-82910659 CTGGAAATAAATACAGAGGACGG + Intergenic
1194067316 X:89277290-89277312 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1194281224 X:91956864-91956886 CTGGAAAGAGATGGGGAGAATGG - Intronic
1194786486 X:98090876-98090898 GTGAAAGCAAAGATGGAGAAGGG + Intergenic
1194806409 X:98333871-98333893 CTGGAAACAGATAGGGATGATGG + Intergenic
1194833641 X:98656483-98656505 GTATAAACAAATCTGGAGAACGG + Intergenic
1195051955 X:101105221-101105243 CTTAAAACATATATGGAGTAGGG + Intronic
1196263246 X:113610594-113610616 CTGGAAAACATTGTGGAGAATGG + Intergenic
1196467221 X:115984523-115984545 CTGGAAAGTGATAGGGAGAATGG + Intergenic
1197615904 X:128691292-128691314 CTGAAAAAAAATATGATGAATGG + Intergenic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1198910562 X:141608673-141608695 CTTGAGAGAAATATGCAGAAAGG + Intronic
1199205396 X:145143297-145143319 GTTGACAAAAATATGGAGAAAGG + Intergenic
1199474128 X:148227473-148227495 CTGGAAACAGATTTGAAGCAAGG - Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199816242 X:151399265-151399287 CTAGAAATTAATATGTAGAAAGG + Intronic
1200598817 Y:5181528-5181550 CTGGAAAGAGATGGGGAGAATGG - Intronic
1200721475 Y:6611504-6611526 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1200761737 Y:7045058-7045080 CAGGAATCCAATATGAAGAAGGG - Intronic
1201262599 Y:12175068-12175090 CAGGAAAGAAATATGGACAGTGG - Intergenic