ID: 996985412

View in Genome Browser
Species Human (GRCh38)
Location 5:129556578-129556600
Sequence CAATCAACTGACCTTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 21, 3: 119, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996985412 Original CRISPR CAATCAACTGACCTTGAAAT AGG Intronic
901115583 1:6841246-6841268 TAATCAGCTGACCTTAAAATAGG - Intronic
901152189 1:7111212-7111234 TAATCAGCTGATCTTGAGATGGG - Intronic
902113679 1:14103748-14103770 TAATCATTTGACCTTCAAATAGG - Intergenic
902923327 1:19680189-19680211 CAATTAACTGACCGTGTACTGGG - Intergenic
903411561 1:23147788-23147810 CTATCAAGTAATCTTGAAATGGG + Intronic
903456832 1:23493330-23493352 TAATCAGCTGACCCTGAAATGGG - Intergenic
903818816 1:26085234-26085256 CAAACAACTGACAAAGAAATTGG - Intergenic
904884731 1:33727475-33727497 CAATCATGTGCCCTTGAAAGAGG - Intronic
905045255 1:34993524-34993546 TAATCAGCTAACCTTAAAATAGG - Intronic
905470811 1:38190378-38190400 TAATCAGCTGACTTTAAAATAGG - Intergenic
909381345 1:75002429-75002451 TAATCAGCTGACCTTAACATAGG - Intergenic
910675728 1:89814805-89814827 CATGCAACTCACATTGAAATAGG - Intronic
911432170 1:97804579-97804601 CAATCAAATGACTTTGACTTTGG - Intronic
911958179 1:104263980-104264002 CCATCTCCTGACCTTGTAATCGG - Intergenic
912465616 1:109871437-109871459 TAATCTACTGGCCTTGAGATGGG + Intergenic
912819756 1:112857420-112857442 TAATCAGCTGGCCTTAAAATAGG + Intergenic
913192109 1:116421573-116421595 TAATCAAGTGATCTTAAAATAGG + Intergenic
914931586 1:151939056-151939078 TAATCAAATGACCTTGCAATAGG - Intergenic
915085213 1:153382988-153383010 CAACCAACTGACCTTGAACAAGG + Intergenic
915635509 1:157183822-157183844 TAATCAGCTGACCTTAAAATAGG - Intergenic
915662153 1:157413524-157413546 TAATCAGCTGACCTTAAAATAGG - Intergenic
916373935 1:164130709-164130731 TAACCAACTGACCTTGAGACAGG - Intergenic
916492717 1:165316034-165316056 CCATCACCTGACCTTGACTTTGG - Intronic
916862874 1:168824972-168824994 TAATCAGTTGACCTTAAAATAGG + Intergenic
917492986 1:175514129-175514151 TCATCAGCTGACCTTAAAATAGG + Intronic
917839671 1:178967683-178967705 TAATCAGCTGCCCTTAAAATAGG + Intergenic
918316751 1:183328820-183328842 CAATCAACTGATGTTGGAATGGG - Intronic
918684846 1:187401549-187401571 CAATTACCTGACCTTAACATAGG - Intergenic
919449076 1:197748478-197748500 CAATCAGCTGACCTTAAAATAGG + Intronic
919529032 1:198693137-198693159 CATTCAACAGATCATGAAATTGG + Intronic
921123686 1:212158401-212158423 TAATTAACTGACTTTGAAATAGG - Intergenic
922244247 1:223779034-223779056 GAATCAGTTGACCTTAAAATAGG - Intergenic
923688918 1:236174560-236174582 GAATCTACTGACCTTGACAATGG + Intronic
924238807 1:242021950-242021972 TAATCTGCTGACCTTAAAATAGG - Intergenic
924320217 1:242841059-242841081 AAGTCAAAAGACCTTGAAATAGG + Intergenic
924370498 1:243343891-243343913 CTATCATCTAACCTTTAAATAGG - Intronic
924525330 1:244841661-244841683 TAATCAACTGACTTGGAAATAGG - Intronic
1062902216 10:1154893-1154915 TACCCAGCTGACCTTGAAATAGG - Intergenic
1064627505 10:17276088-17276110 TAATCAGATGACCTTGAGATGGG - Intergenic
1065313556 10:24439845-24439867 CAGTCAGCTGACCTTGAAATAGG - Intronic
1066237988 10:33505694-33505716 CAATGTACTAACCTTGCAATTGG - Intergenic
1067738814 10:48879973-48879995 GAATCAGCTGACCTTAAAACAGG - Intronic
1067788013 10:49265036-49265058 TACTCAGCTGACCTTAAAATAGG - Intergenic
1068336023 10:55633160-55633182 CAATCAGCTGACCTTAAAATAGG + Intergenic
1068451416 10:57194425-57194447 TAATCAACTGACCATATAATAGG + Intergenic
1069028643 10:63571596-63571618 TAATCAGCTGACCTTGAAATGGG - Intronic
1069532290 10:69228341-69228363 TCATCAGCTGACCTTGAAGTTGG - Intronic
1069781291 10:70957420-70957442 TAATCAGCTGACCTTCAAGTAGG + Intergenic
1070958008 10:80477221-80477243 TAATCAACTGATCTTAACATAGG - Intronic
1070980733 10:80644667-80644689 CAATCAGCTGCCCTGGAAACTGG - Exonic
1071114030 10:82195704-82195726 TAATCAGTTGACATTGAAATGGG + Intronic
1071668740 10:87587252-87587274 TAATCAACTGACTTTGAGAGGGG + Intergenic
1074222889 10:111455570-111455592 GGACCAACTGACCTAGAAATTGG - Intergenic
1074423821 10:113333319-113333341 TAATCAACTGACTTTCAAATAGG + Intergenic
1075978486 10:126717541-126717563 TAATCAGCTGAACTTAAAATAGG + Intergenic
1076375007 10:129977738-129977760 TAATCAACTGACCTTAAAATAGG + Intergenic
1077735859 11:4790116-4790138 CAATCTCCTGACCTTGTGATCGG - Intronic
1078457727 11:11488454-11488476 TAATCAGCTGACCTTGAGTTGGG - Intronic
1078982803 11:16556979-16557001 CATTTAACTGACATTGAAAAAGG - Intronic
1079698459 11:23513902-23513924 TAATCAACTGATTTTAAAATAGG - Intergenic
1079706539 11:23627377-23627399 CAAACAAATGTACTTGAAATCGG - Intergenic
1080403890 11:31961460-31961482 TAATCACCTGATCTTAAAATAGG - Intronic
1080939374 11:36898061-36898083 TAATCAATTGACCTTAAAATAGG + Intergenic
1081000297 11:37661433-37661455 TAGTCAACTGACATTAAAATGGG - Intergenic
1081017134 11:37896441-37896463 TAAGCAGCTGACCTTAAAATAGG + Intergenic
1081149416 11:39608422-39608444 TAATCAACTGAGTTTGAAACAGG + Intergenic
1081350387 11:42044732-42044754 TAATCAGTTGACCTTAAAATAGG - Intergenic
1081602551 11:44505348-44505370 TAATCAGCTGACCTTGAGTTGGG + Intergenic
1083033209 11:59613433-59613455 GAATCAACTGGCCTGGAAAGTGG + Intronic
1084022178 11:66424339-66424361 CAGTCAACTGGCCTTGCAGTGGG - Exonic
1084643537 11:70440547-70440569 TAATCAGCTGGCCTTCAAATTGG + Intergenic
1084840010 11:71838872-71838894 TAATCAGCTGACCTTAAAATAGG - Intergenic
1085197457 11:74681227-74681249 CAATAAACTGACAATGAAAAAGG + Intergenic
1085275426 11:75295569-75295591 TAATTAACTGACCTTAAAATAGG - Intronic
1085545417 11:77313399-77313421 CAATCAATTGACCTAGAAATAGG + Intergenic
1085957040 11:81411199-81411221 TCATCAACTGACTTTAAAATAGG + Intergenic
1086202104 11:84216310-84216332 TAATCAACTAAACTTAAAATAGG - Intronic
1088332658 11:108669692-108669714 TAATCAGCTGACCTTAAAGTAGG + Intronic
1088963480 11:114694202-114694224 TAATTAGCTGACCTTGAGATGGG - Intronic
1089076983 11:115746149-115746171 CACTGAACTAACCCTGAAATGGG + Intergenic
1089161434 11:116440522-116440544 TAATCAGCTGGCCTTAAAATAGG - Intergenic
1092293077 12:7176237-7176259 CAAACAACTCAACTTGAAAATGG - Intergenic
1092486931 12:8910055-8910077 TAATCAGTTGACCTTAAAATAGG - Intergenic
1093970028 12:25367845-25367867 CAAGCAACTCACATTAAAATGGG - Intergenic
1094253460 12:28394241-28394263 CAATCTTCTGACCTTGTGATCGG - Intronic
1094752900 12:33434233-33434255 AAAGCAACTGAACTTGATATAGG - Intronic
1095400121 12:41804684-41804706 TTATCAGCTGACCTTAAAATAGG - Intergenic
1095626692 12:44322925-44322947 TAATCAGCTGACTTTAAAATGGG + Intronic
1095858177 12:46884961-46884983 CAATTAGCTGACTTTAAAATAGG - Intergenic
1096572103 12:52529440-52529462 TAACCACCTGACCTTAAAATAGG + Intergenic
1097848169 12:64387155-64387177 TAATCATTTGTCCTTGAAATAGG - Intronic
1098576784 12:72051707-72051729 TAATCAGCTAACCTTGAAATAGG - Intronic
1098696520 12:73564228-73564250 CAATCAACTGATCTTTGAAAAGG + Intergenic
1098724516 12:73945859-73945881 TTATCAGCTGACCTTAAAATAGG - Intergenic
1098799551 12:74936653-74936675 CAATAAACAGAGATTGAAATTGG + Intergenic
1099019576 12:77386715-77386737 CAGACTACTGACCTGGAAATAGG + Intergenic
1099030491 12:77520267-77520289 TAATCAACTGATCTTGTGATAGG - Intergenic
1099100068 12:78428284-78428306 TAATCAACTGACTTTAAAATAGG + Intergenic
1099436762 12:82655296-82655318 TAATCAGCTGGCCTTAAAATAGG - Intergenic
1099833275 12:87873274-87873296 TAATCAGCTGACCTTAAAATGGG - Intergenic
1099921778 12:88967141-88967163 CAATCCATAGACCTTGATATTGG + Intergenic
1100009657 12:89938060-89938082 CAATGAACTGAGCCTGGAATGGG + Intergenic
1100134739 12:91541696-91541718 AAATCAGTTGACCTTAAAATAGG - Intergenic
1100139575 12:91600534-91600556 TAATCACCTGACATTAAAATAGG - Intergenic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1102963265 12:117107459-117107481 TAATCAGCTGACCCTGAGATGGG + Intergenic
1103495720 12:121360817-121360839 CAATCTCCTGACCTTGTGATCGG + Intronic
1103951373 12:124553274-124553296 TAACCAGCTGACCTTGAGATGGG - Intronic
1104166858 12:126240031-126240053 TAATCAGCTGACATTGAGATGGG - Intergenic
1104371236 12:128225577-128225599 CAATCAGCTGACCTTATAATGGG + Intergenic
1104746580 12:131214793-131214815 CAATCTCCTGACCTTGTGATCGG + Intergenic
1106845900 13:33737544-33737566 TAATCAACTGACCTTAAAATAGG + Intergenic
1107325050 13:39232728-39232750 TAACCAGCTGACCTTGAAATAGG - Intergenic
1107417031 13:40210340-40210362 CCATCAACTAACCTTGAAAAAGG + Intergenic
1107971968 13:45652090-45652112 CAATCAACTGATATTTAAACTGG - Intergenic
1108528622 13:51307510-51307532 TAATCAGCTGACCGTAAAATTGG + Intergenic
1108569845 13:51738772-51738794 CAATAAATTGACCTTCAAAAGGG - Intronic
1108605692 13:52036310-52036332 TTATCAGCTGACCTTAAAATAGG - Intronic
1109108773 13:58289690-58289712 TAATCATCTGATCTTGAGATAGG - Intergenic
1109365343 13:61348449-61348471 TAATTAGCTGACCTTAAAATAGG - Intergenic
1110509239 13:76329290-76329312 TAATCAGCTGATCTTAAAATGGG - Intergenic
1111654149 13:91131211-91131233 CAACTGACTGACCTTAAAATAGG + Intergenic
1112845609 13:103639053-103639075 AAATCAGTTGACCTTAAAATTGG - Intergenic
1113753992 13:112796353-112796375 CAAACAGCTGACATTAAAATAGG + Intronic
1114743016 14:25117686-25117708 CAATTAGCTGACCTTACAATGGG + Intergenic
1115886909 14:37982234-37982256 TAATCAGCTGACTTTAAAATAGG + Intronic
1116268943 14:42735786-42735808 CATTCAACTGATCTTAAAATAGG + Intergenic
1116595443 14:46837603-46837625 CAATCAACAGACATTTAAACTGG - Intergenic
1117467666 14:56009575-56009597 TAATCAGCTGACCTCGAGATGGG - Intergenic
1118041264 14:61919689-61919711 TAATCAGATGACCTTAAAATAGG - Intergenic
1118042329 14:61930672-61930694 TAATCAACTGGCCTTTAAATAGG + Intergenic
1118255839 14:64205116-64205138 TAATCAGCTGACCTTGAAATAGG - Intronic
1119679291 14:76579895-76579917 CAGTCAGCCGACCTTCAAATAGG - Intergenic
1120947289 14:90010489-90010511 TAATCAACTGACCTTAAAATGGG + Intronic
1121182478 14:91939838-91939860 TAAGCAGCTGACCTTGAGATGGG + Intronic
1121284051 14:92720813-92720835 CAATCAGCTGGTCTTAAAATAGG + Intronic
1121447966 14:93990140-93990162 CAATCAATTGACCTTGAACTAGG - Intergenic
1122378864 14:101287378-101287400 TAATCAGCTGACCTTAAAATAGG + Intergenic
1123823911 15:24062001-24062023 CAATCACATGACTTTGAAAGTGG - Intergenic
1123919567 15:25060819-25060841 CAACCAAGTGCCCTTGAAAGTGG - Intergenic
1124233558 15:27967532-27967554 AATTCAACTTACCTTTAAATGGG - Intronic
1125025934 15:35029095-35029117 CAATAAAATGAACTTGTAATTGG + Intergenic
1126371700 15:47953917-47953939 TAATCAGCTGACCTTAAAATAGG - Intergenic
1127120323 15:55766307-55766329 TAATCAGCAGACCTTAAAATAGG - Intergenic
1127485669 15:59415436-59415458 TAATCAGCTGATCTTGAGATGGG + Intronic
1127732807 15:61815971-61815993 CAAACAACAGACTTTGAAAATGG + Intergenic
1128645198 15:69373210-69373232 TAATCCACTGACCTTAAAATAGG - Intronic
1129802308 15:78424406-78424428 TAATCAGCTGACTTTGAGATTGG + Intergenic
1130153434 15:81329831-81329853 CAATCACCTGAGCTTGGAAGAGG + Intergenic
1131239835 15:90729656-90729678 TAATAAGCTGACCTTAAAATAGG - Intronic
1131412449 15:92221137-92221159 CAATCACTTGACCTGGAGATGGG + Intergenic
1131652921 15:94421760-94421782 TAATCATCTGACCTTAAAATAGG - Intronic
1133458381 16:5963612-5963634 TAATCAACTGACCTTCAACAAGG + Intergenic
1133472630 16:6090251-6090273 TAATCATCTGACCTCAAAATAGG - Intronic
1133659107 16:7897540-7897562 TAATCAGCTGGCCTTGAGATGGG - Intergenic
1134341185 16:13347940-13347962 TAATCAGCTGACCTTAAAATAGG + Intergenic
1134841887 16:17408177-17408199 CAATCACCTGCCCTGGAAAATGG + Intronic
1135112743 16:19703423-19703445 TAATCAGCTGACCTTAAAACAGG - Exonic
1135141507 16:19926172-19926194 TAATCAGCTGACCTTGAGGTGGG - Intergenic
1135802450 16:25510549-25510571 CAGTTAACTCAACTTGAAATAGG + Intergenic
1136046012 16:27615575-27615597 CAATCTCCTGACCTTGTGATCGG + Intronic
1138174799 16:54887020-54887042 TAATCAGCTGACTTTAAAATAGG - Intergenic
1138649931 16:58454140-58454162 TAATCAGCTGACTTTAAAATAGG - Intergenic
1139300260 16:65939081-65939103 TAATAAGCTGACCTTAAAATAGG + Intergenic
1140185733 16:72769306-72769328 CAACCACATGACCTTGAAAGAGG - Intergenic
1141066062 16:80915005-80915027 CAAACACCTGGCCTGGAAATGGG + Intergenic
1141258097 16:82422335-82422357 TAATCAGCTGCCCTTAAAATAGG - Intergenic
1141645319 16:85364356-85364378 TAACCAGCTGACCTTGAGATGGG - Intergenic
1141741014 16:85893036-85893058 TAATCAGCTGACCTTACAATAGG + Intergenic
1141748171 16:85940073-85940095 TAATCAGCTGACCTTAAAAGAGG - Intergenic
1141921691 16:87139770-87139792 CAATCTGCTGACCTTAAAATAGG + Intronic
1143204983 17:5135131-5135153 GAATCATCTGAACCTGAAATGGG + Intronic
1143304545 17:5935762-5935784 TAATCAGCCGACCTTAAAATAGG - Intronic
1143334394 17:6161410-6161432 CCTTCCCCTGACCTTGAAATTGG - Intergenic
1144876027 17:18397818-18397840 GAATCATCTGAACCTGAAATGGG + Intergenic
1145156201 17:20546602-20546624 GAATCATCTGAACCTGAAATGGG - Intergenic
1145760651 17:27423838-27423860 GAATCATCTGAACCTGAAATTGG + Intergenic
1146097256 17:29943519-29943541 AAATCAAGTCACATTGAAATTGG + Intronic
1146160713 17:30558126-30558148 GAATCATCTGAACCTGAAATGGG + Exonic
1146883178 17:36454764-36454786 GAATCATCTGAACCTGAAATGGG - Intergenic
1147499429 17:40948612-40948634 TAATCAGCTGGCCTTAAAATAGG + Intergenic
1148982650 17:51592078-51592100 CAATCAGCTGACCTTGAATGGGG + Intergenic
1149111967 17:53045350-53045372 CTATCTACTGACCTTGAGAAGGG + Intergenic
1149195067 17:54109772-54109794 TAATCAGTTGACCTTAAAATAGG + Intergenic
1149227629 17:54493466-54493488 TAATCAGCTGACTTTAAAATGGG + Intergenic
1149284838 17:55150878-55150900 TAATCAACTAACCTTAAAATAGG + Intronic
1149321546 17:55486897-55486919 CCATCAATTGATCTTTAAATTGG - Intergenic
1149375016 17:56035064-56035086 TAATCAGCCGACCTTAAAATAGG - Intergenic
1149846826 17:60013175-60013197 GAATCATCTGAACCTGAAATGGG - Intergenic
1150085176 17:62269749-62269771 GAATCATCTGAACCTGAAATGGG - Intergenic
1150883599 17:69059307-69059329 TAATCAGCTGACTTTGAAATAGG + Intronic
1150899795 17:69259694-69259716 AAATCAACTGACCTGAAAAAGGG + Exonic
1151142727 17:72010473-72010495 TAATCAGCTGACCTTAAAGTAGG + Intergenic
1151864608 17:76792694-76792716 TAATCAGCTCACCTTGAGATGGG + Intergenic
1152395416 17:80030076-80030098 TCAGCAGCTGACCTTGAAATGGG - Intronic
1153076527 18:1167716-1167738 TAATTAGCTGACCTTAAAATAGG + Intergenic
1153321803 18:3780611-3780633 TAAACAACTGACTTTAAAATAGG - Intronic
1153484251 18:5580001-5580023 CAATCACCTTACCCTTAAATTGG - Intronic
1153809978 18:8743774-8743796 TAATCAGCTGACCTTGAAATAGG - Intronic
1153852321 18:9107004-9107026 TAATCAGCCGACCTTAAAATAGG - Intronic
1155161381 18:23198541-23198563 AAATAAGCTGACCTTTAAATGGG + Intronic
1155690096 18:28609844-28609866 CAATCTACTGTCGTTCAAATTGG + Intergenic
1156289626 18:35734935-35734957 TAATCACCTGACCTTCAGATGGG + Intergenic
1156576935 18:38328095-38328117 TAATCAACTAACTTTAAAATAGG + Intergenic
1157509439 18:48259677-48259699 CAAACAACTGTCCCTCAAATGGG + Intronic
1157659681 18:49429249-49429271 TAATCAGCTGACCTTAAAACAGG - Intronic
1158225203 18:55193743-55193765 CAAGAAACTGACATTGACATTGG - Intergenic
1158473758 18:57761534-57761556 CAATCTACTGAACCTGGAATGGG + Intronic
1158513877 18:58114970-58114992 TAATCAGCAGACCTTAAAATAGG - Intronic
1158835438 18:61326696-61326718 TAATCAGCTGACATTCAAATAGG - Intergenic
1159299954 18:66550497-66550519 TAATTAGCTGACCTTGAGATGGG + Intronic
1159347101 18:67220324-67220346 AAATCGACTGACTTTAAAATAGG + Intergenic
1162085110 19:8243998-8244020 TAATCAGCTGAGCTTGAGATGGG + Intronic
1163864975 19:19765572-19765594 CAATCAACTGATCTTCAACAAGG + Intergenic
1164251205 19:23477317-23477339 CCATAAACTGGCCCTGAAATTGG - Intergenic
1167296997 19:48656733-48656755 CAAACAAGAGACCTTGAGATGGG + Intergenic
1168377057 19:55888991-55889013 AAATCAACTGAGCATGAAAATGG + Intergenic
925223600 2:2162543-2162565 CAATCCACTGCCCTGGAAACTGG - Intronic
925497221 2:4465624-4465646 TAATCAGCTGACCTTAAAACAGG + Intergenic
925994898 2:9284086-9284108 TAATCAGCTGAACTTGAGATGGG - Intronic
926235142 2:11035881-11035903 CAATCAACTGACTTTGACAAAGG - Intergenic
926349456 2:11982098-11982120 CAGTCATCTGCCCTAGAAATGGG + Intergenic
926427454 2:12752071-12752093 TAATCAGCTGACCTTAAAATAGG - Intergenic
926591052 2:14740725-14740747 CAATCATCCGATCTTAAAATAGG + Intergenic
927897958 2:26797301-26797323 TAATCAGCTGACATTAAAATAGG + Intronic
927928473 2:27028826-27028848 TAATCTGCTGACCTTAAAATAGG + Intergenic
928318456 2:30264252-30264274 CAATCAGCTGACCTTGGCTTGGG + Intronic
928807587 2:35179090-35179112 CAAACAGCTGACCTTAAAGTAGG - Intergenic
930450313 2:51527650-51527672 TACTCAACTGACCTTGATATGGG - Intergenic
930725991 2:54681842-54681864 TAATCAGCTGACCTTAAAATAGG - Intergenic
932831148 2:74991429-74991451 TAATCAGCTGACCTTAAAATAGG + Intergenic
932900194 2:75689043-75689065 CAATCAACTGAACTCGTATTAGG + Exonic
933176422 2:79178940-79178962 TAATCAGCTGATCTTAAAATAGG + Intergenic
935232201 2:101108754-101108776 TTATCAGCTGACCTTAAAATAGG - Intronic
935712763 2:105913786-105913808 CAATCCCCTGTCCTTGAAACTGG + Intergenic
935999906 2:108817119-108817141 TAATCAGCTGACCTTAAAATAGG + Intronic
937269132 2:120636667-120636689 TAATCAGGTGACCTTGAGATGGG + Intergenic
937351614 2:121167852-121167874 TAATCAACTAATCTTGAGATGGG - Intergenic
937455911 2:122041427-122041449 CAATTAGTTGACCTTAAAATCGG + Intergenic
938224302 2:129602583-129602605 CCATCAACTGCCCTGGAAAGGGG - Intergenic
938404847 2:131025910-131025932 TAATCAGCTGACCTCAAAATAGG - Intronic
938603499 2:132867667-132867689 CCATGAAGTGACCTTGAAAATGG + Intronic
938741848 2:134239624-134239646 TAATCAGCTGACCTTAAAAGGGG - Intronic
939021393 2:136961991-136962013 TAATCAGCTGACCCTGAGATGGG + Intronic
939422804 2:141995483-141995505 CAATCAGCTGACCTTAAAATAGG - Intronic
939506705 2:143055497-143055519 TAATCAATTGACCTTAACATAGG - Exonic
940631172 2:156241138-156241160 AAATCAGTTGACCTTGAGATAGG - Intergenic
940804141 2:158166909-158166931 TAATCACCTGACCTTAAAATAGG + Intergenic
941093031 2:161200331-161200353 CAATAATCTGACCTTGTAAAAGG + Intronic
941923479 2:170873962-170873984 CAATCAGTTGACCTTCAGATAGG + Intergenic
943016502 2:182516921-182516943 TAATCAGCTGACTTTAAAATAGG - Intronic
943318923 2:186423140-186423162 CAATCAAGTGACTTTGGAAGAGG - Intergenic
943426323 2:187739932-187739954 TCATCAGCTGACCTTAAAATAGG - Intergenic
943525681 2:189014338-189014360 TTACCAACTGACCTTGAAATGGG - Intergenic
944088949 2:195883222-195883244 CAATCTCCTGACCTTGTGATCGG - Intronic
944218269 2:197277148-197277170 CAATCTCCTGACCTTGTGATTGG + Intronic
944314328 2:198269107-198269129 TTATCAGCTGACCTTAAAATAGG + Intronic
944505337 2:200404992-200405014 TAATTAGCTGACCTTCAAATGGG - Intronic
945230971 2:207589446-207589468 TAATTAGCTGACCTTAAAATAGG - Intronic
946698248 2:222383756-222383778 AAGTCAGTTGACCTTGAAATAGG - Intergenic
946985942 2:225273370-225273392 CAAACAAGTGACCTTGAAAGGGG - Intergenic
947339674 2:229124587-229124609 TACTCAACAGACCTTGAAAATGG + Intronic
947567820 2:231205994-231206016 TCATCAGCTGACCTTTAAATTGG - Intronic
947982588 2:234423266-234423288 CAATCAGTTGACCTTAAAATAGG + Intergenic
948030294 2:234812181-234812203 TAATCGTCTGACCTTAAAATTGG - Intergenic
1169482701 20:5999751-5999773 TAATCAGGTGACCTTAAAATAGG + Intergenic
1173212533 20:41046945-41046967 CAATCAACTTGACTTGAAAGTGG - Intronic
1174065141 20:47859058-47859080 TAGTCAGCTGACCTTCAAATAGG - Intergenic
1175217134 20:57397239-57397261 CAATCAACAGACCCTGAAGCAGG - Intronic
1176927776 21:14771015-14771037 TCATCAGCTGACTTTGAAATAGG + Intergenic
1177006965 21:15685740-15685762 TAATCAGCTGACCTTAAACTAGG - Intergenic
1178045502 21:28689705-28689727 TTATTAACTGACCTTAAAATAGG + Intergenic
1179034441 21:37747543-37747565 TAATCAGCTGACCTTCAACTGGG + Intronic
1179170851 21:38971651-38971673 CAAACCACTGACCCCGAAATTGG - Intergenic
1179252615 21:39685125-39685147 TAATCATCTGACCTTGAGATGGG - Intergenic
1179317340 21:40255527-40255549 TAATTAACTGATCTTAAAATAGG + Intronic
1179402850 21:41100114-41100136 TAATCAGCCGACCTTGATATAGG - Intergenic
1182127603 22:27827515-27827537 CAGTACACTGACCTTGAACTAGG + Intergenic
1183430748 22:37764132-37764154 TAATCAGCTGACCTTAAAATCGG - Intronic
1183554177 22:38512338-38512360 CAATGAGCTGACCTTGAAGACGG + Intergenic
1184435604 22:44473241-44473263 CCATCAATTGACTCTGAAATGGG - Intergenic
949367171 3:3295207-3295229 CAATCATCTGACCTTCAACAAGG + Intergenic
949438589 3:4056082-4056104 TAATCAGCTGACCATAAAATAGG - Intronic
951557225 3:23932989-23933011 AAATCAGCTGACTTTGAGATGGG + Intronic
952082072 3:29771589-29771611 TAATAAACAGACCTTAAAATAGG + Intronic
953224341 3:41002563-41002585 CAGTCAGCTGACCATGGAATTGG - Intergenic
954804436 3:53208697-53208719 CACTCTACTGTCCTTGAAACTGG + Intergenic
955169594 3:56550344-56550366 TAATCAACCCACCTTAAAATAGG - Intergenic
955666533 3:61355246-61355268 GAATCAAAGGACCTGGAAATGGG - Intergenic
956003573 3:64754499-64754521 TAATCAGTTGACTTTGAAATAGG - Intergenic
956732991 3:72213928-72213950 TAATCAACCGGCCTTAAAATAGG - Intergenic
957156081 3:76546472-76546494 TAATCAACTGACCTTACATTAGG + Intronic
957195262 3:77059536-77059558 CCACCAACTAACCTTTAAATAGG - Intronic
957312367 3:78537433-78537455 TAATCAGCTGACCTTGAGATAGG + Intergenic
957912709 3:86642372-86642394 TAATCAACTGACCTTAAAAAAGG - Intergenic
960743963 3:120865809-120865831 TAATCAACTGCCTTTAAAATAGG + Intergenic
960748546 3:120918240-120918262 TAATCAACTAACCTTGTAATGGG - Intronic
960875112 3:122288072-122288094 TAATCAGCTGACCTTGAGATAGG + Intergenic
960876256 3:122298028-122298050 TAATCAGATGACCTTGAGATAGG + Intergenic
961458417 3:127035651-127035673 CAAAAAAGTGACCTTGAAAAGGG - Exonic
962528524 3:136257147-136257169 TAATCAGCTGGCCTTGCAATAGG + Intronic
962696284 3:137950634-137950656 CAATCAATGGACCTTAAAATAGG - Intergenic
964038547 3:152229765-152229787 CAATCAATTGACCTTAACATAGG + Intergenic
965636556 3:170788089-170788111 TAATCAGCTGACCTTAAATTAGG + Intronic
965982435 3:174710167-174710189 AAATCAGTTGACCTTAAAATAGG + Intronic
966164163 3:176998339-176998361 TTGTCAACTGACCTTGAAATAGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967103104 3:186233148-186233170 CAGTCAATTGACCTTGAGATGGG + Intronic
967224738 3:187280424-187280446 CCATGAAATGAACTTGAAATTGG + Intronic
967452166 3:189637833-189637855 TAATCAACTGACTTTAAAGTAGG + Intronic
967851372 3:194085082-194085104 TAATCAGCTGACCTCGAGATGGG - Intergenic
968024382 3:195427020-195427042 CTATCATCTGACCTTGAGATTGG + Intronic
968328334 3:197841495-197841517 TAATCAGCTGGCCTTAAAATGGG - Intronic
969648371 4:8447576-8447598 CTGTCTACTCACCTTGAAATGGG + Intronic
969781101 4:9404872-9404894 TAATCAGCTGACCTTAAAATAGG - Intergenic
969923840 4:10566419-10566441 TAATCAGCTGACCTTAAAATAGG + Intronic
970141123 4:12983261-12983283 TAATCTGCTGACCTTGAGATAGG - Intergenic
970274651 4:14385419-14385441 TAATCAGTTGACCTTGAGATGGG + Intergenic
971150183 4:24022912-24022934 CCAGCAACTGTACTTGAAATTGG + Intergenic
971605722 4:28654489-28654511 TAATCAGCTCACCTTAAAATGGG - Intergenic
971620717 4:28851151-28851173 TAATAAACTGACCTTAAAATAGG + Intergenic
971657645 4:29370111-29370133 TAATCAGCTGAACTTTAAATAGG + Intergenic
971752371 4:30666853-30666875 TAATCAGCTGACCTTAAAATAGG - Intergenic
971771611 4:30904489-30904511 TAATCAACTGACTTTAAAATGGG - Intronic
971871898 4:32251894-32251916 TAGTCAGCTGACCTTAAAATAGG + Intergenic
971878202 4:32331316-32331338 TAATCAGCTGACCTTAAAATGGG - Intergenic
971977716 4:33711538-33711560 CAAATAACTGACCATGTAATTGG - Intergenic
972416444 4:38845409-38845431 TAATCAACTGATCTTAAAATAGG + Intronic
972576886 4:40359963-40359985 TAATCAACTGACCTAGAGGTGGG + Intergenic
973315917 4:48759833-48759855 TAATCAGCTGACCTTGTAATAGG - Intronic
973329477 4:48897542-48897564 TAATCACCTGACCTTAAAATAGG - Intronic
974096116 4:57366563-57366585 CAATCAACTGACTGTGAATCTGG - Intergenic
975123087 4:70750399-70750421 CAATCAACAGACTTTGAAAATGG - Intronic
975300857 4:72789798-72789820 CAATCAACTTCTCTTGAACTGGG - Intergenic
975338156 4:73205439-73205461 AAATCAATTGACCATAAAATGGG - Intronic
976932031 4:90578623-90578645 CAATCAGCTGAAGTTGAGATGGG - Intronic
977206337 4:94168812-94168834 CAATCTCCTGACCTTGTGATCGG - Intergenic
977415275 4:96724915-96724937 AAATCAATTGTCCTTGAAAAAGG + Intergenic
977849616 4:101809962-101809984 TAATCAGCTGACTTTGAGATAGG + Intronic
978143263 4:105341752-105341774 TAATCAACTGACCATAAAATAGG - Intergenic
978426141 4:108584523-108584545 TAATCAGCTGATCTTAAAATAGG - Intergenic
978447791 4:108797218-108797240 CTATCAGCTGACCTTAAAATAGG + Intergenic
979663052 4:123280746-123280768 TAATCACCTGACCCTAAAATAGG - Intronic
979959032 4:126993324-126993346 TAATCAATTGAACTTAAAATAGG - Intergenic
980082755 4:128361928-128361950 TAATCAGCTGACCTTGAGATTGG + Intergenic
980433983 4:132744536-132744558 CCACCAACTGACCTCTAAATAGG - Intergenic
981184449 4:141784378-141784400 TAATCAGATTACCTTGAAATAGG + Intergenic
981356467 4:143794961-143794983 TAATCAGCTGACCTTGAGAAGGG - Intergenic
981367999 4:143925555-143925577 TAATCAGCTGACCTTGAGAAGGG - Intergenic
981377793 4:144035834-144035856 TAATCAGCTGACCTTGAGAAGGG - Intergenic
981452465 4:144914204-144914226 CAATCATCTGACTTTAAAATGGG - Intergenic
983476415 4:168217609-168217631 GAATCAGCTGACCTTGAGATAGG + Intronic
983615423 4:169699033-169699055 GAAGCAACTGACCTTGAAAAAGG - Intronic
983720550 4:170846448-170846470 TAATCAGCTGACCTTAAAATAGG - Intergenic
983756672 4:171347089-171347111 TAATCAGCTGACCTTAAAATAGG - Intergenic
984113498 4:175648872-175648894 TAGTCAACTGATCTTAAAATGGG - Intronic
984195584 4:176655240-176655262 TGATCAATTGACCTTAAAATAGG + Intergenic
984223392 4:177005360-177005382 GAATCAATTGACCTTAAGATAGG - Intergenic
984809497 4:183782307-183782329 TAATCAATTGACCTTAAAATAGG - Intergenic
986121871 5:4846757-4846779 CCATCATCTGACCTTGACAAAGG + Intergenic
986351078 5:6879914-6879936 TAATCAGTTGACCTTGAGATGGG - Intergenic
986685120 5:10269784-10269806 CAATCAGCTGACCTTAAAAGAGG + Intergenic
986777894 5:11035509-11035531 TAATCAGCTAACCTTGAGATAGG - Intronic
986788734 5:11140051-11140073 CTAACACCTGACCTTAAAATAGG - Intronic
987442129 5:17968613-17968635 TAATAAATTGACCTTAAAATAGG - Intergenic
988025316 5:25679062-25679084 CAATAAACTGACCAGAAAATAGG + Intergenic
988303701 5:29467444-29467466 TAATCATCTGACCTTAAAATAGG + Intergenic
988475459 5:31581088-31581110 AAATCCACTGACTTTGAGATGGG + Intergenic
988995023 5:36706443-36706465 TAATCAACTGATTTTGAAATGGG + Intergenic
989080456 5:37614372-37614394 TAATCAGCTGACCTTAAAATAGG - Intronic
989087955 5:37695753-37695775 TAGTCAGCTGACCTTAAAATAGG - Intronic
989355678 5:40541268-40541290 TAATCAACTGACTTTGAAATTGG - Intergenic
989803842 5:45580194-45580216 AAATCAACAGGCCTTAAAATAGG + Intronic
990865359 5:60373971-60373993 CAATCAACTGAATATGAGATGGG - Intronic
991598731 5:68331371-68331393 AAATCAGCTGACCTTAAAAGAGG + Intergenic
991929195 5:71735328-71735350 TAATCAGCTGACCTTAAGATAGG - Intergenic
992647847 5:78828841-78828863 TAATCAGCTGACTTTCAAATAGG + Intronic
992777956 5:80104761-80104783 TAATAAGCTGACCTTAAAATAGG - Intergenic
993174747 5:84469494-84469516 TAATCAGCTGATCTTAAAATAGG - Intergenic
993342495 5:86741606-86741628 GAATCAGCTGACCATAAAATAGG + Intergenic
993737495 5:91495487-91495509 TAATCAACTGACCTTAAAATAGG - Intergenic
993786362 5:92143190-92143212 TAATCAATTGACTTTGAGATCGG + Intergenic
994000378 5:94772495-94772517 TAATCATCTGACCTTAAAATAGG - Intronic
994583224 5:101674402-101674424 CACTCAAGTCACCTTGAATTAGG + Intergenic
994697707 5:103093227-103093249 TAATCAGATGACCTTAAAATAGG + Intronic
995958493 5:117810343-117810365 TAATCAGCTGACCTTAAAATAGG + Intergenic
996116469 5:119625476-119625498 CAATCATGTCACCTGGAAATAGG + Intronic
996204209 5:120711145-120711167 TAATCTACTAACCTTGAGATGGG - Intergenic
996368535 5:122728330-122728352 TAATCAGCTGACCTTGAAGTAGG + Intergenic
996741882 5:126806998-126807020 CAATCTCCTGACCTTGTGATTGG + Intronic
996985412 5:129556578-129556600 CAATCAACTGACCTTGAAATAGG + Intronic
998305100 5:141068293-141068315 TAATCAACTGACCTTAAAATAGG - Intergenic
998322910 5:141249108-141249130 CAATCAGCTAAACTTAAAATAGG + Intergenic
998539074 5:142962452-142962474 CAATGAAATGATCTAGAAATGGG - Intronic
998623118 5:143816071-143816093 TAATCAGGTGACCTTAAAATAGG - Intronic
998699834 5:144685401-144685423 TTATCAGCTGACCTTAAAATAGG - Intergenic
999056200 5:148579928-148579950 AAATCAGCTGACCTTAAAATAGG - Intronic
999431623 5:151529722-151529744 CAATGGACTGACCTAGAAAATGG - Intronic
1000260891 5:159587583-159587605 CAATCTCCTGACCTTGTGATCGG + Intergenic
1000895180 5:166846623-166846645 TAATCAGCTGACCTTAAAATAGG - Intergenic
1000927001 5:167206018-167206040 TAATCATTTGACCGTGAAATTGG - Intergenic
1001270422 5:170307130-170307152 TAATCAGCTGGCCTTAAAATAGG + Intergenic
1001516623 5:172359790-172359812 TAATCTGCTGACCTTAAAATAGG + Intronic
1001657019 5:173358918-173358940 CAATCAACAGATCTTAAAATAGG - Intergenic
1001801851 5:174551365-174551387 AAATCAACTGACATTTAATTTGG + Intergenic
1003410872 6:5862011-5862033 TAATCAGCTGACTTTGAGATAGG + Intergenic
1003857853 6:10293998-10294020 CAATCTCCTGACCTTGTGATTGG - Intergenic
1003897333 6:10620048-10620070 TGATCAGCTGACCTTAAAATAGG - Intronic
1004026959 6:11828158-11828180 CATTTAACTGCACTTGAAATAGG - Intergenic
1004144758 6:13054973-13054995 CCCTAAACTAACCTTGAAATAGG + Intronic
1004458776 6:15816659-15816681 CCATCAAGTGAGCTGGAAATGGG + Intergenic
1004459587 6:15823212-15823234 TAATCAGATGACCTTGAGATGGG - Intergenic
1004888318 6:20072817-20072839 TAATCAGTTGACCTTAAAATAGG - Intergenic
1005275387 6:24211511-24211533 TAAGCAGCTGACCTTGAGATGGG + Intronic
1005276917 6:24229439-24229461 TAATCAGCTGACCTTGGAATAGG - Intronic
1005666011 6:28056596-28056618 TAATCAACTGACCTTGAAGCTGG - Intergenic
1005678660 6:28182858-28182880 CTATCACCTGACCTTAAAATAGG - Intergenic
1006206724 6:32350706-32350728 TAATCAGCTGACCTTAAAATAGG + Intronic
1006532033 6:34663869-34663891 TAATCAGCTGACCTTAAAATAGG + Intronic
1007010746 6:38415247-38415269 TAATCAGCTGACTTTAAAATGGG + Intronic
1008016280 6:46523791-46523813 CAAGAAACTAACGTTGAAATGGG - Intergenic
1008034051 6:46727625-46727647 TAATCAGTTGACCTTAAAATAGG + Intronic
1008360969 6:50618606-50618628 CACTCAACTGACTTTGACAGGGG + Intergenic
1009268468 6:61587987-61588009 CAATTAAATGAACTAGAAATTGG - Intergenic
1009753214 6:67899840-67899862 CAGTCAACTGACCCTAAAACCGG + Intergenic
1009965855 6:70577193-70577215 TAATCAGATGACCTTAAAATAGG - Intronic
1010865592 6:80973619-80973641 TAATTATCTGACCTTCAAATAGG - Intergenic
1010881585 6:81180729-81180751 CAAAGAAATGACCTTCAAATTGG + Intergenic
1011216401 6:85010526-85010548 CCAGCAACTGTACTTGAAATTGG - Intergenic
1011626003 6:89284437-89284459 GAATCAGCTGACCTTACAATGGG + Intronic
1012342227 6:98141987-98142009 CAAACAGCTGACCTTAAAATGGG - Intergenic
1012433395 6:99189689-99189711 TAATTAACTGACCTTGAAATGGG - Intergenic
1012806336 6:103898209-103898231 AAATCAACTGACCTTAAAACAGG - Intergenic
1013438267 6:110135690-110135712 TAATCAGCTGACCTCAAAATAGG + Intronic
1013439792 6:110152106-110152128 TTATCAGCTGACCTTAAAATTGG + Intronic
1013995064 6:116298317-116298339 TCATCAGCTGACCTTGAGATAGG + Intronic
1014756297 6:125304981-125305003 TAATCAGCTGAACTTTAAATAGG + Intergenic
1015020628 6:128469717-128469739 TAATCAGCTGACGTTGAGATGGG + Intronic
1015080211 6:129215132-129215154 GAATCAAGTGACTTAGAAATTGG + Intronic
1015896373 6:138020822-138020844 TAATCAGCTGAACTTAAAATAGG - Intergenic
1016138377 6:140576269-140576291 AAATCAACAGACTTTAAAATAGG + Intergenic
1016341299 6:143064195-143064217 AAATCAATTGACCTTAAAATAGG + Intronic
1016504174 6:144759587-144759609 AAATCAACTGACCTTTAATTAGG + Intronic
1016593651 6:145774069-145774091 AAATCAACTGACCTTAAGATAGG - Intergenic
1016924402 6:149328513-149328535 CAATCTCCTGACCTTGTGATTGG + Intronic
1017032003 6:150232322-150232344 CAATCCTTTGACCTTGATATAGG + Intronic
1018443276 6:163833017-163833039 TAATCCGCTGACCTTAAAATAGG - Intergenic
1018998354 6:168727073-168727095 CAATCTCCTGACCTTGTGATCGG + Intergenic
1019761890 7:2819015-2819037 CAATCAGCTGAGCTTAAAATAGG + Intronic
1020572068 7:9876013-9876035 GTATCACCTGACCTTAAAATAGG - Intergenic
1021421136 7:20445822-20445844 TAATCAAGTGACCTTGAGATAGG - Intergenic
1021881021 7:25095657-25095679 TTATCAGCTGACCTTAAAATAGG + Intergenic
1022302023 7:29110757-29110779 TAATCAACTGGCCTTAAAATAGG + Intronic
1022981251 7:35606821-35606843 TAATCAACTGACCTTATGATTGG - Intergenic
1023273215 7:38489197-38489219 CAGTCAACTGATCTTCAAAAAGG + Intronic
1023395950 7:39752290-39752312 AACTCATCTGACTTTGAAATGGG - Intergenic
1023528133 7:41126636-41126658 CAAACAACTGACATTGAACGAGG + Intergenic
1023981266 7:45071862-45071884 TTATCAGCTGACCTTGAAATAGG - Intronic
1024184853 7:46939635-46939657 GACTCATCTGACCTTGAGATGGG + Intergenic
1024873920 7:53999300-53999322 CAAACAACAGAACATGAAATTGG - Intergenic
1024927791 7:54636208-54636230 TAATCAGCTGACTTTAAAATTGG + Intergenic
1024933919 7:54692279-54692301 CAATCACATGACCTTGGAAGAGG + Intergenic
1025212753 7:57030062-57030084 CAAACAACTGACTTTCAAATTGG + Intergenic
1025659200 7:63546762-63546784 CAAACAACTGACTTTCAAATTGG - Intergenic
1026260279 7:68748893-68748915 TAATCAGCTGACCTTGAAATAGG + Intergenic
1027536626 7:79411294-79411316 TAATCAGCTGACCTTTAAATAGG + Intronic
1028035785 7:85980119-85980141 CAATCATGTGATCTTGAAAGAGG + Intergenic
1028150603 7:87367139-87367161 TAGTCAGTTGACCTTGAAATGGG + Intronic
1028172790 7:87618706-87618728 TAATCAGTTGACCTTGAGATAGG + Intronic
1028495686 7:91457147-91457169 GAATCAGCTGACTTTGAAAGAGG + Intergenic
1028720717 7:94027794-94027816 CAATCAACTCACCTTAAAATAGG + Intergenic
1030267220 7:107632736-107632758 TAATCAGCTGACTTTAAAATAGG - Intergenic
1030644969 7:112050332-112050354 CAATCCAGTGACCTTAACATTGG - Intronic
1030860958 7:114627805-114627827 CAAGCAACTGAGCTTATAATAGG - Intronic
1030951653 7:115798172-115798194 TAATCAGTTGACCTTGAAATAGG + Intergenic
1031466615 7:122120117-122120139 AAATCAACTGAAATAGAAATGGG - Intronic
1031970215 7:128059449-128059471 TAATCAACTGACCAAGAAATGGG - Intronic
1033547411 7:142413926-142413948 CAATCAGCTGACCTTCATACTGG - Intergenic
1033550162 7:142439570-142439592 CAATCAGCTGACCTTAATATAGG - Intergenic
1033578762 7:142712386-142712408 TAATCAGCCGACCTTGAGATAGG - Intergenic
1033594652 7:142849620-142849642 TAATCAGCTAACCTTGAGATGGG + Intergenic
1033668207 7:143463831-143463853 AAATCAATTGACCTTAAAATAGG - Intergenic
1033707526 7:143903547-143903569 TAATTAGCTGACCTTGAGATGGG - Intergenic
1033765320 7:144483212-144483234 TAATCAGCTGACCTTAAAATAGG + Intronic
1033869387 7:145732060-145732082 TAATCACCTGACCTTGAGATGGG + Intergenic
1034959896 7:155358638-155358660 CAAGCCAGTGACCTTGAAAGAGG - Exonic
1036162676 8:6404463-6404485 CAATCTCCTGACCTTGTGATCGG + Intergenic
1036278539 8:7378812-7378834 TAATCACCTGACCTTAAAATAGG - Intronic
1036279535 8:7388424-7388446 TAATCAGCTGACTTTCAAATAGG - Intergenic
1036341983 8:7923453-7923475 TAATCAGCTGACTTTCAAATAGG + Intergenic
1036342985 8:7933074-7933096 TAATCAGCTGACCTTAAAATAGG + Intronic
1036517906 8:9461994-9462016 CAACCATCTGAGCTTGAAAGTGG + Intergenic
1036838323 8:12093831-12093853 TAATCAGCTGACCTTAAAATAGG + Intergenic
1036860113 8:12340079-12340101 TAATCAGCTGACCTTAAAATAGG + Intergenic
1037035203 8:14158321-14158343 TAATAAATTGACCTTAAAATAGG + Intronic
1037563380 8:20095156-20095178 TAATCAGCTGACCTTGGAATGGG + Intergenic
1038534732 8:28345955-28345977 CAATCATGTGACTTTTAAATTGG - Exonic
1038588601 8:28813980-28814002 CAATCTCCTGACCTTGTGATAGG + Intronic
1039232677 8:35465739-35465761 TACTCAGCTGACCTTAAAATAGG + Intronic
1039272341 8:35896498-35896520 CATTCAAATGACTTAGAAATTGG - Intergenic
1039706045 8:40008482-40008504 TAATCAGTTGACCTTGACATAGG - Intronic
1040280107 8:46036421-46036443 CCATCCACTGAACTTGAGATCGG + Intergenic
1040494904 8:47958039-47958061 TAATCAGCTGACCTTAAAATGGG + Intronic
1040740032 8:50562289-50562311 TAATCAGCTGGCCTTAAAATGGG + Intronic
1041142383 8:54836397-54836419 TAATTAGCTGACCTTAAAATAGG + Intergenic
1041736023 8:61111287-61111309 CAATCAACTGTCATTTAAAAGGG - Intronic
1042057520 8:64781688-64781710 TAATCAGCTGACCTTAAAATAGG - Intronic
1042741670 8:72054636-72054658 CAAGCAACTGACCTGCAAAGGGG - Intronic
1044846134 8:96383654-96383676 AAATCAACTGACCTTAAGGTGGG - Intergenic
1044875201 8:96658591-96658613 TAATCATCTGGCCTTAAAATAGG + Intronic
1044942950 8:97361808-97361830 TAATCAGCTGACCTTTAAATAGG + Intergenic
1045139417 8:99263733-99263755 TAATCAGCTGACCTTGAAATAGG - Intronic
1046186041 8:110720322-110720344 AAATAAACTTACCTTGAAACTGG - Intergenic
1046854491 8:119015732-119015754 CAAACTACTGCCCCTGAAATTGG - Intronic
1046919016 8:119707732-119707754 AAATCAAGTGACCTTGGAAGTGG + Intergenic
1046964753 8:120151780-120151802 TAATCAGTTGACCTTAAAATAGG + Intronic
1047052557 8:121129123-121129145 TAATCAAACGACCTTAAAATAGG + Intergenic
1047211553 8:122844315-122844337 GAATCAGCTGACATTGCAATTGG + Intronic
1047256058 8:123214404-123214426 TAATCAGCTGACATTAAAATAGG - Intergenic
1047365219 8:124205139-124205161 TAATCAGCTGACCTTAAAATTGG + Intergenic
1047467238 8:125128877-125128899 TAATCAGCTGACCTTGCAGTGGG - Intronic
1048061847 8:130927421-130927443 CAATCACCTGATTTTAAAATGGG - Intronic
1050097177 9:2078719-2078741 CAATCTCCTGACCTTGTGATCGG - Intronic
1050244469 9:3673430-3673452 CAACCAGCTGACCTAAAAATGGG - Intergenic
1051687163 9:19669794-19669816 TAATCAGCTGACCTTGAGATGGG - Intronic
1052018692 9:23499754-23499776 TAATCAACTGGTCTTAAAATAGG + Intergenic
1052675189 9:31613237-31613259 GAATCAACTGACCTTTAAATAGG + Intergenic
1055363756 9:75522830-75522852 TAATCAGCTGACTTTGAGATTGG + Intergenic
1055501847 9:76909129-76909151 TAATGAACTGACCTTGAAATGGG - Intergenic
1056058936 9:82862304-82862326 TAATCAGCTGACCTTAAAATAGG - Intergenic
1056299040 9:85222835-85222857 TAATCAGCTGACCTTACAATAGG - Intergenic
1056479037 9:86982345-86982367 TAATCAGCTGACTTTAAAATAGG + Intergenic
1056969322 9:91189273-91189295 TAATCAGCTGACCCTGAAGTGGG + Intergenic
1057543432 9:95998414-95998436 GAATCAGCTGACCTTGAGATGGG + Intronic
1057589427 9:96359387-96359409 TAATCAAAAGACCCTGAAATGGG + Intronic
1057860566 9:98637509-98637531 TAATCAGCTGACCTTAAAGTAGG + Intronic
1058036995 9:100263609-100263631 TAATCAGCTGAACTTGAGATGGG - Intronic
1058952534 9:109917009-109917031 CAAACAGCTGACTTTAAAATAGG + Intronic
1060315770 9:122509111-122509133 TAATCAGCTGACTTTAAAATGGG - Intergenic
1062078421 9:134605145-134605167 CAATCTCCTGACCTTGTGATCGG - Intergenic
1186103000 X:6176508-6176530 CAGTCAGCAGACCTCGAAATGGG + Intronic
1187203755 X:17161295-17161317 TAATCAGTTGACCTTAAAATAGG + Intergenic
1188919790 X:35958819-35958841 TAATCAACCCACCTTAAAATAGG + Intronic
1189429282 X:40932733-40932755 CTGTCCACTGGCCTTGAAATTGG + Intergenic
1190364790 X:49681698-49681720 TAATAATCTGACCTTAAAATGGG - Intergenic
1191148001 X:57189541-57189563 CAAGCAGATGACCTTTAAATGGG + Intergenic
1191859056 X:65651039-65651061 TAATCAGCTGACCTTGAGATGGG - Intronic
1191901464 X:66045179-66045201 AAATCAATTGACCTTAACATAGG + Intergenic
1192093675 X:68187294-68187316 TAATCAGATGACCTTGAGATAGG + Intronic
1192730173 X:73795201-73795223 TAATCAGCTGACCTTGAGATGGG + Intergenic
1193090890 X:77492977-77492999 TAATTAACTGAACTTGCAATGGG - Intergenic
1193288336 X:79740018-79740040 TAATCAGCTGACCTTAAGATAGG + Intergenic
1194163305 X:90483035-90483057 AAGTCAACTGCCATTGAAATGGG + Intergenic
1194391696 X:93325905-93325927 CAATCAGCTAACCTTAAAAGAGG - Intergenic
1195028864 X:100906988-100907010 AAATCAGTTTACCTTGAAATAGG - Intergenic
1195247966 X:103013598-103013620 CAATCATTTGACCTTAAGATAGG - Intergenic
1195486447 X:105413323-105413345 TAATTAGCTGACCTTGAGATAGG + Intronic
1195657605 X:107347198-107347220 CAAACAACTATCCTTTAAATAGG - Intergenic
1196779006 X:119365621-119365643 AAATCAGTTGACCTTAAAATAGG - Intergenic
1196840674 X:119856110-119856132 TAATCAGCTGTCCTTAAAATAGG - Intergenic
1197333506 X:125182325-125182347 TAATCGGCTGACCTTAAAATAGG - Intergenic
1197346525 X:125330207-125330229 TAATCAACTATCCTTAAAATAGG + Intergenic
1197496732 X:127193218-127193240 GAATCAATTGACCTTAAAATAGG + Intergenic
1199199612 X:145071661-145071683 CAATCTCCTGACCTTGTGATAGG + Intergenic
1199899411 X:152158396-152158418 TAATCAGTTGACCTTAAAATAGG - Intergenic
1200320801 X:155187063-155187085 TAATCAAATGACTTTAAAATCGG + Intergenic
1200509575 Y:4060760-4060782 AAGTCAACTGCCATTGAAATGGG + Intergenic
1201492411 Y:14556757-14556779 CAGTCAGCAGACCTTGAAATTGG - Intronic
1201638108 Y:16147934-16147956 AAATCAACTGTCTTTGACATGGG + Intergenic