ID: 996985941

View in Genome Browser
Species Human (GRCh38)
Location 5:129564590-129564612
Sequence GATTTTACGAGGATTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996985937_996985941 3 Left 996985937 5:129564564-129564586 CCGATGAGACAGTAAAACAGCAA 0: 1
1: 0
2: 3
3: 31
4: 376
Right 996985941 5:129564590-129564612 GATTTTACGAGGATTTTGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996985941 Original CRISPR GATTTTACGAGGATTTTGGA AGG Intronic
907633180 1:56105701-56105723 AATTTGAGGAGGATTTGGGAAGG - Intergenic
911195955 1:94995923-94995945 GAAATTAGGAGGTTTTTGGAGGG + Intronic
911308135 1:96257166-96257188 TTTTTTAGGAGGTTTTTGGAGGG - Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
919284468 1:195537403-195537425 GAATTTATGAAGATATTGGAGGG + Intergenic
919357906 1:196549544-196549566 TATATTACTAGAATTTTGGAAGG - Intronic
923297314 1:232607505-232607527 AATTTTATGGGGATTTGGGATGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1064446183 10:15395527-15395549 GTTTCTACTAGAATTTTGGAAGG - Intergenic
1065691101 10:28334816-28334838 CATTTCAATAGGATTTTGGAAGG - Intergenic
1068221952 10:54056716-54056738 GATTTTGGGTGGCTTTTGGAAGG - Intronic
1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG + Intergenic
1074248716 10:111722113-111722135 GAAATTAAGAGGATTTTAGAAGG - Intergenic
1074754481 10:116614323-116614345 GTTTTGACGTGAATTTTGGAGGG - Intergenic
1078385154 11:10884241-10884263 GTTTTTATTAGGATTTTAGAAGG + Intergenic
1078797172 11:14603995-14604017 GATTTTCAGAGTATTTTGTAGGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1080974102 11:37314850-37314872 CATTTTATGAGGATTTAGCAGGG + Intergenic
1080993310 11:37568769-37568791 TCTTTTCTGAGGATTTTGGAGGG - Intergenic
1081354616 11:42096892-42096914 AATTTTACAGGGATTTTGTAAGG - Intergenic
1082897899 11:58212597-58212619 GATTTTATTAAGATCTTGGAAGG + Intergenic
1089311797 11:117562934-117562956 TATTTTATAAGGATGTTGGAAGG + Intronic
1090703731 11:129317933-129317955 GTTTTCACGTGAATTTTGGAGGG - Intergenic
1093623823 12:21323298-21323320 TATATTCCCAGGATTTTGGAAGG + Intronic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1097463997 12:59900335-59900357 AAATTTACAAGCATTTTGGAGGG - Intergenic
1100226857 12:92566433-92566455 CATTTTAATAGGCTTTTGGATGG - Intergenic
1101054804 12:100901410-100901432 CATTTTCCCAGCATTTTGGAAGG + Intronic
1104751353 12:131241730-131241752 TATTTAAAGAGGATTTAGGATGG - Intergenic
1104764713 12:131320107-131320129 TATTTTACCAGGATTTTGACTGG - Intergenic
1104778814 12:131406668-131406690 TATTTTGGAAGGATTTTGGAGGG - Intergenic
1105276832 13:18937696-18937718 GAAGTTACGAGGATATGGGATGG - Intergenic
1106598108 13:31163899-31163921 ATTTTTGCTAGGATTTTGGAAGG + Intergenic
1106627231 13:31433235-31433257 GATTTTACAGGGACTTAGGAAGG + Intergenic
1108125145 13:47234440-47234462 TATTTTTCCAGGATTTTGGTGGG - Intergenic
1112605463 13:100901066-100901088 GATTAAACTGGGATTTTGGATGG + Intergenic
1112754178 13:102612009-102612031 AATTTTAGTAGCATTTTGGAAGG + Intronic
1114438507 14:22727673-22727695 GATCTTAGGAGCATTTTGGGAGG + Intergenic
1116538749 14:46069901-46069923 GATTTTACAAATATTTTTGAAGG + Intergenic
1122638656 14:103143476-103143498 GATTTTAAGATGAATTTGGGGGG - Intergenic
1126224565 15:46255541-46255563 GATTTTGCCAGGATTTTGATTGG - Intergenic
1128291482 15:66481763-66481785 GAGTTGACTAGGATGTTGGAGGG - Exonic
1128877381 15:71213476-71213498 GATTGTGGGAGGCTTTTGGAAGG - Intronic
1133653534 16:7835977-7835999 GTTTTTAGGAAGATTTTGGAGGG + Intergenic
1134319993 16:13154031-13154053 GTTTTTGCAAGGATTTTGGCAGG + Intronic
1135121247 16:19768272-19768294 GATTATATGAGTATTATGGATGG + Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1139108904 16:63864546-63864568 CATTTTAAGAACATTTTGGAAGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1150704608 17:67475805-67475827 AATTTTAGGAGGATTTTTCAAGG + Intronic
1155669662 18:28354373-28354395 GATTTTAGATGGATTTTTGATGG + Intergenic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1161407978 19:4101113-4101135 GAGTTCACGAGGATGTTGGAGGG + Exonic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
932547950 2:72735178-72735200 GAATTTAGGAGTATTATGGAGGG - Intronic
937433034 2:121856395-121856417 TGTTTTAGGAGGGTTTTGGAGGG + Intergenic
938989744 2:136615719-136615741 GTTTTAACATGGATTTTGGAGGG - Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
942555044 2:177163975-177163997 GATCTTACTAGGGTTATGGAGGG - Intergenic
944014946 2:195024855-195024877 GATTGGACATGGATTTTGGAGGG - Intergenic
944961705 2:204882378-204882400 AATTTTAGGAGGATTATAGAAGG - Intronic
945701312 2:213174309-213174331 GATTATATGAGGTTTTTTGAGGG - Intergenic
1169659716 20:7964830-7964852 GATTTTACAAGGAAACTGGAGGG - Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1175425735 20:58864796-58864818 GATTTTAGAAGCATTTTGGGGGG + Intronic
1178779920 21:35592851-35592873 TATTCTGGGAGGATTTTGGAGGG - Intronic
1181946826 22:26524645-26524667 GATAATATGAGGCTTTTGGAAGG - Intergenic
1182534824 22:30993041-30993063 GATGTTATGAGGAATTTGGAAGG - Intergenic
953038342 3:39233000-39233022 TATTTTAAGATGGTTTTGGAGGG + Intergenic
953677146 3:45011806-45011828 GACTTTCCCAGGATTTGGGATGG - Intronic
956129537 3:66039954-66039976 GATTTGAGGAGTATTTGGGAAGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
962024457 3:131532526-131532548 GATCTCACGAGGATGTTGGGAGG + Intergenic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962514411 3:136136744-136136766 GATTTTAAGTTGTTTTTGGAGGG - Intronic
964652665 3:159028751-159028773 GATTTTACAATGGCTTTGGAGGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
976593661 4:86874268-86874290 GATATTAAGAGCCTTTTGGAAGG + Intergenic
978626043 4:110686485-110686507 GACCTTACCTGGATTTTGGAGGG + Intergenic
981977526 4:150748730-150748752 GTTTCTACAAGAATTTTGGAGGG - Intronic
983106128 4:163688773-163688795 TAGTTTTCTAGGATTTTGGAAGG - Intronic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984880900 4:184409317-184409339 GACTTTTTGAGGATTTTGGGGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
993474348 5:88345966-88345988 AAATATAAGAGGATTTTGGAAGG - Intergenic
994888204 5:105593883-105593905 TATTTTAAAAGGATTTGGGAAGG + Intergenic
996985941 5:129564590-129564612 GATTTTACGAGGATTTTGGAAGG + Intronic
998389917 5:141780676-141780698 GATTTAAGGAGGATTATGCAGGG - Intergenic
1003389902 6:5704401-5704423 GATTTTAACATGAATTTGGAGGG + Intronic
1005668920 6:28085001-28085023 GATTTGACTAGGATGTGGGAGGG - Intronic
1007896669 6:45369102-45369124 CATTTTAAGTGGACTTTGGAAGG + Intronic
1009784224 6:68311353-68311375 GATTTTAAGAAGACTTTGCAAGG + Intergenic
1010173275 6:72997401-72997423 GATGTTAAGAGGAAATTGGAGGG - Intronic
1012713687 6:102640645-102640667 GATTTTACAAGAATTTTTGGGGG + Intergenic
1013095546 6:106941406-106941428 GACTTTAAGGAGATTTTGGAGGG + Intergenic
1015750969 6:136558433-136558455 GATTATACCAGGTTTTTGGAGGG + Intronic
1017362485 6:153592139-153592161 GATTTTAAGAGGAGTTGGCATGG + Intergenic
1019643860 7:2118781-2118803 GATATGACGTGGCTTTTGGAGGG - Intronic
1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG + Intergenic
1021006736 7:15405464-15405486 TATTTTACGTGGTTCTTGGAAGG + Intronic
1024533335 7:50410579-50410601 GATTTACAGAGGATTTTGCAAGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027457893 7:78416639-78416661 GATTCCACATGGATTTTGGAGGG - Intronic
1028126492 7:87119048-87119070 TATTTTACAAGGATATTGGAAGG - Intergenic
1028534704 7:91879668-91879690 GATATTATGAGTATTTTGAATGG - Intronic
1030710276 7:112740788-112740810 GATTTTACTGGGATGTTGAAGGG - Intergenic
1031070009 7:117151778-117151800 AGTTTTACGAGGATTTGGGGTGG - Intronic
1032117180 7:129127103-129127125 GAGTTCACGAGGATGTTGGAGGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035071937 7:156151420-156151442 CATTTGACCTGGATTTTGGATGG + Intergenic
1036009611 8:4707472-4707494 AATTTTTAGAGGATTTAGGAAGG + Intronic
1036612397 8:10361545-10361567 CATTTTACCAGGATTCTTGAAGG + Intronic
1037106441 8:15113755-15113777 GATTGTAGGAGGATTGTAGAGGG - Intronic
1038101282 8:24379240-24379262 GATCTTACTAGGATTTTGATTGG - Intergenic
1039052216 8:33505418-33505440 GACTTTAGGAGGTTTTGGGAAGG - Intronic
1039688687 8:39837957-39837979 TATTCTACGTGGATTTTGGGTGG + Intronic
1040446050 8:47494606-47494628 GATTTTACAAGGCTTTTGTGAGG + Intronic
1041810797 8:61907445-61907467 GTTGTTACTAGGAATTTGGAGGG - Intergenic
1042051609 8:64715604-64715626 GATATTATGAGGATTTTTGTAGG - Intronic
1042429949 8:68694189-68694211 CATTTTCCTAGGATTTTTGAAGG - Intronic
1044890552 8:96830832-96830854 CATTTTAAGAGGAATTAGGAAGG - Intronic
1045760122 8:105595492-105595514 GATTTTAAGAAGAGTTTTGAAGG + Intronic
1046637149 8:116682460-116682482 GGTTTTGAGAGGTTTTTGGAGGG - Intronic
1048546416 8:135391458-135391480 GATTTTTCTAGGACTTTGGGAGG + Intergenic
1053199993 9:36145783-36145805 GATGGTTCGAGGATGTTGGATGG + Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056495681 9:87152806-87152828 GATTTTAGTGGGATCTTGGAAGG + Intronic
1057584630 9:96318147-96318169 GCTTTTAAGAGGCTTCTGGAGGG - Intergenic
1058375166 9:104314514-104314536 CAATTTAATAGGATTTTGGAAGG - Intergenic
1058639031 9:107065161-107065183 GATTTTGCAAGGAGTTTGCAAGG - Intergenic
1059167458 9:112092332-112092354 CATTTTATGAGGATTTTATAAGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1187659663 X:21528182-21528204 CATTTTAGTAGGATATTGGATGG - Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190759722 X:53429415-53429437 GGTATTAAGAGGGTTTTGGATGG - Intronic
1190832609 X:54072913-54072935 GATTTCTCCAGGATTTTGGTGGG - Exonic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic