ID: 996991205

View in Genome Browser
Species Human (GRCh38)
Location 5:129634611-129634633
Sequence TAGGTTTGCAACCTTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1117
Summary {0: 1, 1: 2, 2: 28, 3: 230, 4: 856}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996991205_996991207 15 Left 996991205 5:129634611-129634633 CCAGAAACAAGGTTGCAAACCTA 0: 1
1: 2
2: 28
3: 230
4: 856
Right 996991207 5:129634649-129634671 TGACAAACCTGTTCAATAAATGG 0: 1
1: 0
2: 3
3: 55
4: 1578
996991205_996991208 21 Left 996991205 5:129634611-129634633 CCAGAAACAAGGTTGCAAACCTA 0: 1
1: 2
2: 28
3: 230
4: 856
Right 996991208 5:129634655-129634677 ACCTGTTCAATAAATGGCTCTGG 0: 1
1: 0
2: 21
3: 372
4: 3358
996991205_996991210 22 Left 996991205 5:129634611-129634633 CCAGAAACAAGGTTGCAAACCTA 0: 1
1: 2
2: 28
3: 230
4: 856
Right 996991210 5:129634656-129634678 CCTGTTCAATAAATGGCTCTGGG 0: 1
1: 9
2: 264
3: 2689
4: 18066

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996991205 Original CRISPR TAGGTTTGCAACCTTGTTTC TGG (reversed) Intronic
900251970 1:1675571-1675593 TAGGTTTGCAACTGTGGTTTTGG - Exonic
900262381 1:1738429-1738451 TAGGTTTGCAACTGTGGTTTTGG - Exonic
901723367 1:11218514-11218536 TAGGTTTTCTACTTTCTTTCAGG - Intronic
902083875 1:13841677-13841699 TAGGTGTACAACATTATTTCTGG + Intergenic
902085562 1:13858080-13858102 TAGATGTGCAACCTTATTTCTGG + Intergenic
902175254 1:14645110-14645132 TGGGTGTGCAGCCTTATTTCTGG + Intronic
904235416 1:29113437-29113459 AGGCTTTGCAGCCTTGTTTCTGG - Intronic
904331403 1:29759961-29759983 TCAGTTTGAAACCTTGTTCCTGG - Intergenic
905074716 1:35259674-35259696 TACATTTGCAACCTTGGTTCTGG + Intergenic
906578446 1:46912855-46912877 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
906851465 1:49254846-49254868 TAGGTATGCAGCTTTGTTTCTGG - Intronic
906895779 1:49769646-49769668 TAGGTGTGCAGCTTTATTTCTGG - Intronic
906997889 1:50816991-50817013 TAGGTGTGCAGCATTATTTCTGG + Intronic
907624500 1:56015658-56015680 TAGGTGTGTGGCCTTGTTTCTGG - Intergenic
907634719 1:56122505-56122527 TAGGTGTGCAGCCTTTTTCCTGG + Intergenic
907751159 1:57264616-57264638 TAGGGGTTCAACCTTGTTTAAGG - Intronic
908226732 1:62063314-62063336 TAGGTGTGCAACTTTGTTTCTGG + Intronic
908664234 1:66472202-66472224 TAGGTGTGTACCCTTATTTCTGG + Intergenic
908818951 1:68063060-68063082 TAGATATGCAGCCTTATTTCTGG - Intergenic
909163062 1:72179312-72179334 TAGGTGTGCAGCTTTATTTCTGG + Intronic
909266133 1:73559738-73559760 TAGGTTTGCTTGCTTGTTTAAGG + Intergenic
909267621 1:73581002-73581024 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
909353663 1:74682729-74682751 TGGGTTTGCAACCTATTCTCAGG + Intergenic
909374893 1:74928748-74928770 TAGGTGTGCAGTCTTGTTTCTGG - Intergenic
909397442 1:75186372-75186394 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
909661425 1:78087428-78087450 TAGCTGTGCAGCCTTATTTCTGG - Intronic
909679197 1:78272582-78272604 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
910190876 1:84594174-84594196 TAGGTGTGTAACCTTATTTCTGG - Intergenic
910589415 1:88913583-88913605 TAGGTTTGTAGCTTTATTTCTGG + Intergenic
910651303 1:89571020-89571042 TAGGTATGCAGTCTTATTTCTGG + Intronic
910813228 1:91259238-91259260 TAGGTGTGCAGCCTTAATTCTGG - Intergenic
911148551 1:94574791-94574813 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
911385133 1:97165260-97165282 TAGGTGTGCAGCCTTATTTCTGG - Intronic
911514270 1:98847734-98847756 TAGGTGTGCAGCATTATTTCTGG + Intergenic
911667747 1:100573129-100573151 TAGATATGCAGCCTTATTTCTGG - Intergenic
911748631 1:101469822-101469844 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
912279656 1:108299564-108299586 TAGGTGTGTATCCTTATTTCTGG + Intergenic
912288570 1:108394793-108394815 TAGGTGTGTATCCTTATTTCTGG - Intronic
912588961 1:110794815-110794837 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
912594738 1:110863102-110863124 TAGATGTGCAGCCTTATTTCTGG + Intergenic
912595158 1:110868396-110868418 TAGGTGTGCAGCATTATTTCTGG - Intergenic
912647637 1:111409951-111409973 TAGGTGTGCATTCTTATTTCTGG - Intergenic
912665360 1:111574266-111574288 TAGGTGTGCGGCCTTATTTCTGG + Intronic
912857500 1:113183315-113183337 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
912957049 1:114162178-114162200 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
913322801 1:117600990-117601012 TGATTTTTCAACCTTGTTTCTGG + Intergenic
913573837 1:120149199-120149221 TAGGTGTGCAGCATTATTTCTGG + Intergenic
914295098 1:146314001-146314023 TAGGTGTGCAGCATTATTTCTGG + Intergenic
914414242 1:147464068-147464090 TAGGTGTGCAACCTTATTTCTGG + Intergenic
914556139 1:148764784-148764806 TAGGTGTGCAGCATTATTTCTGG + Intergenic
914616695 1:149365447-149365469 TAGGTGTGCAGCATTATTTCTGG - Intergenic
915005642 1:152632898-152632920 TAGGTGTGCAGCCTTATTCCTGG - Intergenic
915375125 1:155387442-155387464 TAGGTGTGCAGTCTTATTTCTGG + Intronic
915817345 1:158982450-158982472 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
916599528 1:166278264-166278286 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
916643256 1:166755132-166755154 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
917302585 1:173592176-173592198 TAGGTGTGCAGCCTTATTTTTGG + Intronic
917585306 1:176420485-176420507 TAGGTGTGCATCCTTATTTCTGG + Intergenic
917689587 1:177454466-177454488 TAGGTGTGCGGCCTTATTTCTGG + Intergenic
917697494 1:177541288-177541310 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
918024526 1:180730197-180730219 TAGGTGTGCAGCTTTATTTCTGG + Intronic
918095666 1:181331890-181331912 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
918137901 1:181692484-181692506 TAGGTTTGCAGCCTTATGCCTGG - Intronic
918165740 1:181945782-181945804 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
918389403 1:184042461-184042483 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
918481025 1:184976952-184976974 TAGGTGTGCACCTTTATTTCTGG - Intergenic
918677538 1:187306147-187306169 TAGGTGTGCATTCTTATTTCTGG - Intergenic
918854038 1:189727849-189727871 TGGGTGTGCAGCCTTATTTCTGG + Intergenic
918867228 1:189917856-189917878 TAGGTTTGTGCCCTTATTTCTGG + Intergenic
918872490 1:189993219-189993241 TATGTTTGTTACCTTCTTTCAGG - Intergenic
918925886 1:190785427-190785449 TAGGTATGCAACCTTATTTTGGG - Intergenic
918974354 1:191462807-191462829 TAGATGTGCATCCTTATTTCTGG - Intergenic
919203715 1:194392970-194392992 TAGGTGTGCAACCTTACTTCTGG - Intergenic
919207899 1:194440680-194440702 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
919287523 1:195583090-195583112 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
919435540 1:197555014-197555036 TAGGTGTGCAGCTTTATTTCAGG - Intronic
919453167 1:197794529-197794551 TTGGTATGCAGCCTTATTTCTGG + Intergenic
919617379 1:199824464-199824486 TAGGTGTGCAGCTTTATTTCCGG - Intergenic
919627066 1:199921808-199921830 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
919965051 1:202514735-202514757 TAGGTGTGCAACCTTATTTCAGG + Intronic
920836568 1:209516362-209516384 TATGTTTGCTACCTTGTATTAGG + Intergenic
920890538 1:209980757-209980779 TAGGTGTGCAGTCTTATTTCTGG + Intronic
921298922 1:213731077-213731099 TAGGTATGCAGTCTTATTTCTGG + Intergenic
921640431 1:217546442-217546464 CAGGTGTGCAGCCTTATTTCTGG - Intronic
921653445 1:217706018-217706040 TAGGTGTGCAGCGTTATTTCTGG + Intronic
921841060 1:219828996-219829018 TAGATGTGCAGCCTTATTTCTGG + Intronic
921942538 1:220857184-220857206 TAGGTTTGTAGATTTGTTTCTGG + Intergenic
922040757 1:221893955-221893977 CAGGTATGCAACTTTATTTCTGG - Intergenic
922069695 1:222179531-222179553 TAGGTGTGCGACTTTATTTCTGG - Intergenic
923645536 1:235816745-235816767 TAGGTGTGCAGCTTTATTTCTGG - Intronic
924324680 1:242883652-242883674 TAGGTGTGCATCTTTATTTCTGG - Intergenic
924619165 1:245645655-245645677 TGGGTTTGCAACCTGATTCCTGG + Intronic
924819534 1:247475428-247475450 TAGGTTTGCAATGTTATTTCTGG - Intergenic
924860262 1:247913116-247913138 TAGGTGTGCAGCTTTGTGTCAGG - Intergenic
1064187096 10:13171564-13171586 CAGCTTTGCAACCTTGTCTCTGG - Intronic
1064776493 10:18783864-18783886 TAGGTGGGCAACTTTATTTCTGG + Intergenic
1065059730 10:21887568-21887590 TAGGTGTGCAGCCTTATTTCTGG - Intronic
1065329557 10:24580481-24580503 TAGTTTTTAAACTTTGTTTCAGG - Intergenic
1065502978 10:26400037-26400059 TTGCTTTGCTACCTTGTGTCAGG + Intergenic
1065592221 10:27275826-27275848 TAGGTATGTAACCTTGTTTCTGG - Intergenic
1065658135 10:27974537-27974559 TAGGTGTGCAGCCTTGTTTCTGG + Intronic
1066137778 10:32467894-32467916 TAGGTGTGCAGCCTTATTTCTGG + Intronic
1066144033 10:32537802-32537824 TAGGTGTGCAGCCTTATTTCTGG + Intronic
1066173278 10:32875443-32875465 TAGATGTGCAGCCTTATTTCTGG + Intronic
1067825147 10:49566193-49566215 TAGATGTGCAGCCTTATTTCTGG - Intergenic
1067924375 10:50493148-50493170 TAGGTATGCAGTCTTATTTCTGG - Intronic
1068071449 10:52201363-52201385 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1068192530 10:53669830-53669852 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1068396457 10:56467931-56467953 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1068485408 10:57652008-57652030 TAGGTGTGCAACCTTATTTCTGG + Intergenic
1068586026 10:58799655-58799677 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1068640545 10:59400430-59400452 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1068832685 10:61515686-61515708 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1068850684 10:61736450-61736472 TAGATGTGCAGCCTTATTTCTGG + Intronic
1069076724 10:64045036-64045058 TAGTTTTACAACTTTGATTCTGG - Intergenic
1069149704 10:64944222-64944244 CAGGTGTGCAACTTTATTTCTGG - Intergenic
1069186072 10:65424878-65424900 CAGGTTGGCAACCTTTTTTCTGG + Intergenic
1069277284 10:66608618-66608640 CAGGTGTGCAGCCTTATTTCTGG - Intronic
1069296881 10:66857211-66857233 TAGGTGTGCAGCCTTATTTCTGG + Intronic
1069340996 10:67408417-67408439 TAGGTGTGCAGTCTTATTTCTGG - Intronic
1069811655 10:71164846-71164868 TAGGTGTGAAGCCTTATTTCTGG - Intergenic
1070054189 10:72918784-72918806 TAGGTGTGCAGTCTTATTTCTGG + Intronic
1071095888 10:81974217-81974239 TAGGTATGCAGTCTTATTTCTGG + Intronic
1071249173 10:83798962-83798984 TAGGTGTTCAACTTTATTTCTGG + Intergenic
1071367899 10:84919213-84919235 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1071418880 10:85468915-85468937 TAGGTATGCAGCCTTGTTTCTGG - Intergenic
1071543883 10:86512964-86512986 TCAGTTTGTAATCTTGTTTCTGG + Intronic
1071924181 10:90386654-90386676 TAGATATGCAACTTTATTTCTGG - Intergenic
1071991804 10:91107045-91107067 TAGGTGTGCAATCTTGTTTCTGG + Intergenic
1072576121 10:96701727-96701749 CAGGCTTGCAACCCTGTCTCTGG + Intronic
1072870982 10:99119777-99119799 TAGATGTGCAGCCTTATTTCTGG - Intronic
1072883653 10:99253315-99253337 TAGGTGTGCAGCTTTGTTTCTGG - Intergenic
1073552223 10:104414270-104414292 ATGGTTGGCAAACTTGTTTCTGG - Intronic
1073880800 10:107977439-107977461 TAGGTGTGCAGCCTTTTTTCTGG + Intergenic
1073944633 10:108736202-108736224 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1073990041 10:109252314-109252336 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1074190685 10:111132964-111132986 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1074248463 10:111718255-111718277 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1074566419 10:114582692-114582714 TAGGTATGTAACTTTATTTCTGG - Intronic
1074689365 10:115990559-115990581 GAGGTTTGCATCCTGGTTACAGG + Intergenic
1074734299 10:116412460-116412482 TAGGTTTGGAACCTTTTTGAAGG + Intergenic
1074739735 10:116474127-116474149 TAGGTATGCGGCCTTATTTCTGG - Intronic
1075164721 10:120056984-120057006 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1076609787 10:131716704-131716726 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1076870756 10:133192331-133192353 TAGGCGTGCAGCCTTATTTCTGG - Intronic
1077003780 11:340557-340579 TAGGCTTCAAATCTTGTTTCTGG + Intergenic
1077352259 11:2098478-2098500 TTGGTTTGCATCCTTGGTTTGGG - Intergenic
1077742845 11:4866765-4866787 TAGGTGTGTAATCTTCTTTCTGG - Intronic
1078303382 11:10157099-10157121 TAGGTGTGCAGTCTTATTTCTGG - Intronic
1078395470 11:10977632-10977654 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1078630308 11:12996991-12997013 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1078694367 11:13615623-13615645 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1078997814 11:16721870-16721892 TAGATGTGCAGCCTTATTTCTGG - Intronic
1079285554 11:19127759-19127781 TAGGCGTGCAGCCTTGTTTCTGG + Intronic
1079777110 11:24545595-24545617 TAGGTGTGCAGTCTTATTTCTGG + Intronic
1079992420 11:27260334-27260356 TAGGTGTGCAACTTTATTTCTGG - Intergenic
1080023522 11:27589596-27589618 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1080218484 11:29873063-29873085 TAAGTGTGCAGCCTTATTTCTGG + Intergenic
1080488748 11:32739002-32739024 TAGGTGTGTGACTTTGTTTCTGG + Intronic
1080818290 11:35779915-35779937 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1081095723 11:38932002-38932024 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1081504511 11:43701638-43701660 TAGGTGTGCAGATTTGTTTCTGG + Intronic
1081708118 11:45198198-45198220 TAGGTTTCTAACCTGGTGTCTGG - Intronic
1081835839 11:46153267-46153289 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1082703129 11:56458682-56458704 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1084926348 11:72515620-72515642 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1085243900 11:75082207-75082229 TAGGTATGCAGCTTTATTTCTGG - Intergenic
1085444954 11:76594641-76594663 TAGGTTTGCAGTCTTATTTCTGG - Intergenic
1085876375 11:80411218-80411240 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1085906297 11:80768220-80768242 TAGGTGTGCAACTTTGTTTCTGG + Intergenic
1085939857 11:81196146-81196168 TAGGTTTGCAGCCTTATTTCTGG + Intergenic
1086045329 11:82525156-82525178 AAGGTTTTCAACCTCCTTTCAGG - Intergenic
1086045878 11:82530972-82530994 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1086050194 11:82580331-82580353 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1086526492 11:87733382-87733404 TAGGTGTGCATCATTATTTCTGG + Intergenic
1086756669 11:90572566-90572588 TAGGTTTGTCACTTTATTTCTGG + Intergenic
1087300745 11:96431864-96431886 TAGGTGTGCTGCCTTATTTCTGG - Intronic
1087495297 11:98883551-98883573 TAGGTGTGCAGACTTATTTCTGG - Intergenic
1087669357 11:101087263-101087285 TAGGTGTGCACCTTTATTTCTGG - Intronic
1087848703 11:103003504-103003526 TAGGTATGCGGCCTTATTTCTGG - Intergenic
1087954335 11:104266345-104266367 TAGGTGTGCCGCCTTATTTCTGG - Intergenic
1088149928 11:106732208-106732230 TAGGTTTGCGGCCTGATTTCTGG - Intronic
1088652531 11:111970806-111970828 TAGGTGTGGAACTTTATTTCTGG - Intronic
1089380332 11:118026102-118026124 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1090217152 11:124979105-124979127 TAGGTGTGCAGCATTATTTCTGG + Intronic
1090495133 11:127204542-127204564 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1090500543 11:127256714-127256736 CAGGTTTGCTACCTTGTCTGAGG - Intergenic
1090572682 11:128065120-128065142 TAGATGTGCAGCCTTATTTCTGG - Intergenic
1091525844 12:1300147-1300169 TAGGTGTACAGCCTTATTTCTGG - Intronic
1091528836 12:1334543-1334565 TAGATGTGCAACCTTATTTTGGG + Intronic
1091541309 12:1465232-1465254 TAGGTTTGCAGCATTGGTGCAGG - Intronic
1091850033 12:3688498-3688520 TGGGTGTGCAGCCTTATTTCTGG + Intronic
1092274728 12:7050830-7050852 TAGGTTTGCATCCTTATTTCTGG + Intronic
1092393781 12:8106197-8106219 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1092608698 12:10149194-10149216 TAGGTGTGCAACTTTATTTCTGG + Intergenic
1093019505 12:14189999-14190021 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1093150316 12:15612891-15612913 TAGGTATGCAACTTTATTTCTGG + Intergenic
1093239673 12:16654605-16654627 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1093388482 12:18587937-18587959 TAGGTGTGCAGCCTTATTTCTGG - Intronic
1093408320 12:18833723-18833745 TAGGTGTGCAGACTTATTTCTGG - Intergenic
1093476774 12:19564610-19564632 TAGGTGTGCAACATTATTTCTGG + Intronic
1093492742 12:19724070-19724092 TAGGTGTGCGGCCTTATTTCTGG - Intergenic
1093545940 12:20348127-20348149 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1093753275 12:22825859-22825881 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1093770625 12:23013437-23013459 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1093968373 12:25351290-25351312 TAGGTATGCAGCTTTATTTCTGG - Intergenic
1094759468 12:33513876-33513898 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1095697811 12:45160426-45160448 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1095816466 12:46427962-46427984 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1096010210 12:48207249-48207271 CAGGTGTGCAACTTTATTTCTGG - Intergenic
1096031982 12:48426392-48426414 TAGGTTTGAGACCTTCTTTCTGG + Intergenic
1096563735 12:52457900-52457922 TAGGTGTGCAGACTTATTTCTGG + Intergenic
1097133217 12:56829378-56829400 TAAGTGTGCAGCCTTATTTCTGG - Intergenic
1097337401 12:58398263-58398285 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1097638200 12:62146998-62147020 TAGGTATGCAGCTTTATTTCAGG - Intronic
1097751825 12:63363589-63363611 TAGGTGTGCAACTTTATTTCTGG + Intergenic
1098145576 12:67494469-67494491 TAGGTGTGTGGCCTTGTTTCTGG - Intergenic
1098571821 12:71996461-71996483 TAGTTCTGAAACCTTGGTTCTGG + Intronic
1098632830 12:72745364-72745386 TAGGTGTGCATCATTATTTCTGG - Intergenic
1098872327 12:75830612-75830634 TAGGTGTGCAGCCTCATTTCTGG - Intergenic
1098938927 12:76512494-76512516 TAGGTATGCAGCCTTATTTCTGG + Intronic
1099002548 12:77196529-77196551 TAGTTTTGAAACATTTTTTCTGG + Intergenic
1099301324 12:80898279-80898301 TTGGTGTGCAACATTATTTCTGG + Intronic
1099497773 12:83373949-83373971 TACGTTTGTGACCTTATTTCTGG + Intergenic
1099577431 12:84399323-84399345 TAGGTTTGAAGCTTTTTTTCTGG - Intergenic
1099865973 12:88281489-88281511 TAGGTGTGCAACCTTATTTCTGG - Intergenic
1100222217 12:92517515-92517537 TTTGTTTCCAACCTTCTTTCTGG + Intergenic
1100880762 12:99014204-99014226 TAGGTGTGCAGTCTTATTTCTGG - Intronic
1100928536 12:99579030-99579052 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1101113875 12:101512783-101512805 TAGGTGTGCGACTTTATTTCTGG + Intergenic
1101180274 12:102209184-102209206 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1102322608 12:111950513-111950535 TAGATGTGCAGCCTTATTTCTGG - Intronic
1102723735 12:115039901-115039923 TAGGTATGCAACTTTGGTTATGG + Intergenic
1104331450 12:127850421-127850443 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1105164967 13:17495505-17495527 CAGGTTTGAAACACTGTTTCTGG + Intergenic
1105166214 13:17515234-17515256 CAGGTTTGAAACACTGTTTCTGG + Intergenic
1105167177 13:17530366-17530388 CAGGTTTGAAACACTGTTTCTGG + Intergenic
1105176607 13:17677559-17677581 TAGGTTTGAAACACTCTTTCTGG + Intergenic
1105179135 13:17716502-17716524 CAGGTTTGAAACACTGTTTCTGG + Intergenic
1105180747 13:17741662-17741684 CAGGTTTGAAACACTGTTTCTGG + Intergenic
1105189635 13:17880491-17880513 CAGGTTTGAAACACTGTTTCTGG + Intergenic
1105197070 13:17995734-17995756 CAGGTTTGAAACATTCTTTCTGG + Intergenic
1105198792 13:18022951-18022973 CAGGTTTGAAACACTGTTTCTGG + Intergenic
1105235842 13:18552832-18552854 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1106021751 13:25922363-25922385 TATTATTGCAACCTTGTTTTAGG + Intronic
1107116207 13:36748543-36748565 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1107570583 13:41653742-41653764 TAGGTGGGCAACTTTGTTTCTGG - Intronic
1108031965 13:46241154-46241176 TAGGTATGCAGCCTTATTTCTGG - Intronic
1108130516 13:47294674-47294696 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1108155701 13:47582882-47582904 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1108231801 13:48352144-48352166 TAGGTGTGCAACCTTATTTCTGG + Intronic
1108496611 13:51031656-51031678 TAGGTGTACAGCCTTATTTCTGG - Intergenic
1108795529 13:54025376-54025398 TAGGTATGCAGCCTTATTTCTGG - Intergenic
1108854804 13:54779625-54779647 TAGGTGTGCAGCCCTATTTCTGG - Intergenic
1109002293 13:56820857-56820879 TAAGTATTCAACCTTATTTCTGG + Intergenic
1109095006 13:58102862-58102884 TGGGTCTGCAACTTTATTTCTGG + Intergenic
1109325720 13:60865381-60865403 TAGGCATGCAGCCTTATTTCTGG + Intergenic
1109577501 13:64281071-64281093 TAGGTGTGCCACTTTATTTCTGG - Intergenic
1109685285 13:65812024-65812046 TAGGTGTGCAACTTTATTTTTGG + Intergenic
1109941345 13:69370152-69370174 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1110069416 13:71154757-71154779 TAGATGTGCAGCCTTATTTCCGG + Intergenic
1110230187 13:73159878-73159900 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1110272113 13:73602674-73602696 TAGGTGCGTAACCTTATTTCTGG - Intergenic
1110334719 13:74314386-74314408 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1110481989 13:75989381-75989403 TAGGTGTGCATCATTATTTCTGG - Intergenic
1110989931 13:82027258-82027280 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1111179270 13:84640656-84640678 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1111526042 13:89472039-89472061 TAGGTGTGCAGCCTCATTTCTGG + Intergenic
1112104167 13:96222574-96222596 TAGTTTTGTTACCTTGTTGCTGG + Intronic
1112721119 13:102246921-102246943 TAGGAGTGCAACCTTATTTCTGG - Intronic
1112736192 13:102421914-102421936 TATGTGTGCAGCCTTATTTCTGG - Intergenic
1112745007 13:102517331-102517353 TAGGTTAACAACCTTGTATCCGG + Intergenic
1112782786 13:102919735-102919757 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1112908504 13:104453650-104453672 CAGGTGTGCGACCTTATTTCTGG - Intergenic
1112916708 13:104560091-104560113 TAGTTATGCAGCCTTATTTCCGG + Intergenic
1113340111 13:109414507-109414529 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1113390131 13:109888352-109888374 TAGGTGTGTGGCCTTGTTTCTGG - Intergenic
1113586055 13:111466378-111466400 TAGGTGTGCAGCTTTATTTCAGG + Intergenic
1113697964 13:112361435-112361457 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1113712043 13:112472194-112472216 TAGATGTGCAGCCTTATTTCTGG - Intergenic
1114154112 14:20079947-20079969 TAGGTGTGCAACTTTATTTCTGG - Intergenic
1114160110 14:20155919-20155941 TAGGTATGCAGCCATATTTCTGG - Intergenic
1114586732 14:23821717-23821739 TAGGTGTGTAGCCTTGTTTCTGG + Intergenic
1115890930 14:38027985-38028007 TAGGTGTGCAGCTTTATTTCAGG - Intronic
1116024888 14:39503056-39503078 TAGGTGTGCAGCTTTATTTCAGG + Intergenic
1116138290 14:40955813-40955835 TAGGTATGCAGCTTTATTTCTGG + Intergenic
1116348567 14:43828879-43828901 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1116521948 14:45859666-45859688 TAGGTGTGCGACTTTATTTCTGG + Intergenic
1116592495 14:46796215-46796237 CAGATGTGCAACCTTATTTCTGG + Intergenic
1116648542 14:47561002-47561024 TAGGTGTGCAGCATTATTTCTGG + Intronic
1116931869 14:50698730-50698752 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1117079284 14:52134816-52134838 TAGATGTGCAAGCTTATTTCTGG - Intergenic
1117244293 14:53868453-53868475 TAGATGTGCAACCTGATTTCTGG - Intergenic
1117345903 14:54832135-54832157 TAGGTGTGCAGCTTTATTTCCGG + Intergenic
1117451912 14:55859804-55859826 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1117901711 14:60540690-60540712 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1118215575 14:63805050-63805072 TAGGTGTGCAACTTTATTTCTGG + Intergenic
1120051110 14:79867356-79867378 TTGATCTGCAACTTTGTTTCTGG - Intronic
1120141690 14:80936604-80936626 TAGTTTTTAAAGCTTGTTTCTGG - Intronic
1120163241 14:81168010-81168032 TAGGTTTCCATCCATGTTCCTGG + Intergenic
1120279037 14:82415642-82415664 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1120300580 14:82701398-82701420 TAAGTGTGCAGCCTTATTTCTGG + Intergenic
1120336004 14:83155902-83155924 TGGGTTTGCAGCTTTATTTCTGG - Intergenic
1120638292 14:86978776-86978798 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1120723411 14:87911933-87911955 TAGGTGTGAAGCCTTATTTCTGG + Intronic
1122421581 14:101581185-101581207 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1122589222 14:102834276-102834298 TAGGTGTGCAGCCTTATTTCTGG - Intronic
1124153501 15:27204357-27204379 TAGGTATGCAGCTTTATTTCTGG + Intronic
1124228925 15:27924167-27924189 TAGGTGTACAGCCTTATTTCTGG + Intronic
1125273379 15:37965095-37965117 TAGGTGTGCATATTTGTTTCTGG - Intronic
1125309619 15:38364509-38364531 TAGGTGTGCAGCCTTATGTCTGG + Intergenic
1125382205 15:39098495-39098517 TAGGTGTGCAACTTTATTGCTGG + Intergenic
1125780858 15:42266021-42266043 TAGGTGTGCGGCCTTATTTCTGG + Intronic
1125787706 15:42336314-42336336 TAGGTGTGCAACCTTATTTCTGG - Intronic
1125891801 15:43272625-43272647 TAGGTATGGGGCCTTGTTTCTGG + Intergenic
1126253330 15:46594636-46594658 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1126507081 15:49417502-49417524 TGGGTGTGCAGCCTTATTTCTGG - Intronic
1126530782 15:49708778-49708800 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1126871278 15:52990878-52990900 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1126871896 15:52998314-52998336 TAGGTATGCGGCCTTATTTCTGG - Intergenic
1126957112 15:53945553-53945575 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1127054994 15:55122215-55122237 TAGGTGTGCAGCCTTATCTCTGG - Intergenic
1127679663 15:61281006-61281028 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1127767881 15:62205426-62205448 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1128401437 15:67285761-67285783 TAGGTGTGCAGTCTTATTTCTGG + Intronic
1129013232 15:72441996-72442018 CAGGTGTGCCACCTTATTTCTGG + Intergenic
1129553969 15:76485716-76485738 TAGGTATGCAGTCTTATTTCTGG - Intronic
1129954237 15:79619601-79619623 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1130345282 15:83038732-83038754 TAGGTCTGCAGCTTTATTTCTGG - Intronic
1130367937 15:83257426-83257448 TTGGTTTGCCATCTTGTTACTGG + Exonic
1130397784 15:83518978-83519000 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1131964655 15:97829022-97829044 TAGGTGTGCAGCCCTATTTCTGG - Intergenic
1132144787 15:99423228-99423250 TAGGTGTTCAGCCTTATTTCTGG + Intergenic
1132245214 15:100290687-100290709 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1134418428 16:14064768-14064790 TAGATGTGCAACTTTATTTCTGG + Intergenic
1137064412 16:35825038-35825060 TAGGTGTGCCATCTTATTTCTGG + Intergenic
1137330354 16:47488754-47488776 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1138281420 16:55774624-55774646 TAGCTTTGAAAGCTTGTTTGGGG + Intergenic
1138306885 16:55985612-55985634 TAGGTATGCAGCCTTATTTCTGG + Intergenic
1140595205 16:76400848-76400870 TAGGTATGCAGCCTTATTTCTGG + Intronic
1142551097 17:740239-740261 TAGGCTTGCAGCCTTCCTTCCGG + Intronic
1142942312 17:3391561-3391583 TAGGTATGCAATCTTATTTCTGG + Intergenic
1143816107 17:9516906-9516928 ATGGTTTTCAACCTTCTTTCTGG + Intronic
1144383080 17:14722273-14722295 TAGGTGTGTAGCCTTATTTCTGG - Intergenic
1145121653 17:20265893-20265915 TAGGTTTGCAGCTCTATTTCTGG + Intronic
1145315862 17:21733257-21733279 TAGGTATGCGGCCTTATTTCTGG + Intergenic
1145714286 17:27005187-27005209 TAGGTATGCGGCCTTATTTCTGG + Intergenic
1146822453 17:35994898-35994920 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1147529183 17:41258170-41258192 TAGGTGTGCAACATTATTTCTGG + Intergenic
1149147869 17:53519251-53519273 TAGATGTGTAACTTTGTTTCTGG + Intergenic
1149245849 17:54706761-54706783 TAGGTGTGCGATCTTATTTCCGG + Intergenic
1149577188 17:57722585-57722607 GAGGTTTCCCACCTTTTTTCTGG - Intergenic
1150537572 17:66058994-66059016 TAGGTGTGCATCATTATTTCTGG - Intronic
1150921865 17:69492460-69492482 TAGGTGTGCAGCCTTATTTCTGG + Intronic
1153168402 18:2287862-2287884 TAGGTGTGCAGCCTTGTTTCTGG + Intergenic
1153680414 18:7495367-7495389 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1153785790 18:8533926-8533948 TAGATGTGCAGCCTTGCTTCTGG - Intergenic
1153819304 18:8819460-8819482 TAACTTTGCCCCCTTGTTTCAGG + Intronic
1154371833 18:13770566-13770588 TAGATGTGCAACTTTGCTTCTGG - Intergenic
1154402927 18:14059197-14059219 CAGGTGTGCAGCTTTGTTTCTGG + Intronic
1154513699 18:15137166-15137188 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1155085016 18:22450007-22450029 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1155091146 18:22512829-22512851 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1155480322 18:26279690-26279712 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1155666047 18:28309682-28309704 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1155920932 18:31602124-31602146 TAGGTTTGGAGGCTTGTTTTGGG - Intergenic
1156068001 18:33168393-33168415 TAGGTGTGCAGCATTATTTCTGG + Intronic
1156402320 18:36750793-36750815 TAGGTGTGTGACCTTATTTCTGG + Intronic
1156429220 18:37053167-37053189 TAGATGTGCTACCTTATTTCTGG - Intronic
1156926861 18:42592238-42592260 TAGATGTGCAACTTTATTTCTGG + Intergenic
1156954863 18:42950236-42950258 TAGGTGTGCAGCTTTATTTCCGG - Intronic
1156965744 18:43089720-43089742 TAAGTATGCAGCCTTATTTCTGG - Intronic
1158098432 18:53802187-53802209 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1159111369 18:64060285-64060307 TAGGTGTGCACCTTTATTTCTGG + Intergenic
1159131454 18:64284623-64284645 TAGGTTTTAAACCTTATTTAAGG + Intergenic
1159417327 18:68169710-68169732 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1159456647 18:68667908-68667930 TAGATGTGCAGCCTTATTTCTGG - Intergenic
1159641457 18:70867274-70867296 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1159865067 18:73693801-73693823 TTGCTTTGTAACTTTGTTTCTGG - Intergenic
1163231256 19:16004124-16004146 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1164043773 19:21515892-21515914 TAGGTGTGCAGCATTATTTCTGG + Intronic
1165967117 19:39591632-39591654 TAGGTGTGTGACCTTATTTCTGG - Intergenic
1165972779 19:39646910-39646932 TAGGTGTGTGACCTTATTTCTGG - Intergenic
925017275 2:540229-540251 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
925322788 2:2989260-2989282 TAGATGTGCAATCTTATTTCTGG + Intergenic
925608218 2:5680983-5681005 TAGGTTTGCAGCCTTATTTGTGG + Intergenic
925647352 2:6049980-6050002 TAAGTTTGCAGACTTATTTCTGG - Intergenic
926557159 2:14372159-14372181 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
926761423 2:16282101-16282123 TCGGTTTTCAGCCTAGTTTCTGG - Intergenic
926968981 2:18447343-18447365 TAGGTGTGCAACTTTATATCTGG - Intergenic
927273629 2:21241398-21241420 TAAATGTGCAGCCTTGTTTCTGG + Intergenic
927425066 2:22972369-22972391 TAGGTGTGCAAATTTGTCTCTGG - Intergenic
928470559 2:31571203-31571225 TAGGTATGCAGCATTGTTTCTGG - Intronic
928592284 2:32829697-32829719 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
928597608 2:32870871-32870893 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
930334916 2:50033308-50033330 TAGGTGTGCAGCCTTATTTCTGG - Intronic
930528987 2:52568123-52568145 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
930563746 2:52993928-52993950 TAGATGTGCAGCCTTATTTCTGG + Intergenic
930928241 2:56847870-56847892 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
930965448 2:57318462-57318484 TAGGTGTACAGCCTTATTTCTGG - Intergenic
930996901 2:57730389-57730411 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
932033393 2:68213990-68214012 TAGGTGTGCAACATTATTTCTGG - Intronic
932482727 2:72056885-72056907 TAGGTGTGCTGCCTTATTTCTGG + Intergenic
932880480 2:75496869-75496891 TAGGTGTGCAGCTTTATTTCTGG - Intronic
932913212 2:75827096-75827118 TAGGTGTGCAGCCTTCCTTCTGG - Intergenic
933365658 2:81350433-81350455 TCGGTGTGCAGCCTTATTTCTGG - Intergenic
933642095 2:84774373-84774395 TAGGTGTGCAGCTTTATTTCTGG + Intronic
934549477 2:95247189-95247211 TAGGTATGCAACTTTATGTCTGG - Intronic
934996154 2:98962675-98962697 TAGGTGTGCAGCCTTACTTCTGG + Intergenic
935449705 2:103195088-103195110 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
936274938 2:111087482-111087504 TAGGTGTGCAGCATTATTTCTGG - Intronic
936782002 2:116044685-116044707 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
936844006 2:116807924-116807946 TAGTTCTGCAGCCTTGTTGCAGG + Intergenic
936847779 2:116857347-116857369 TAGGTGTGCAGCCTTATTCCTGG - Intergenic
937607944 2:123825008-123825030 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
938513940 2:131981777-131981799 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
938990265 2:136620856-136620878 TAGGTGTGCAGCATTATTTCTGG + Intergenic
938999304 2:136715419-136715441 TAGGTGTGCAAGCTTATTTCTGG - Intergenic
939089462 2:137762008-137762030 TAGGTGTGCAGCATTATTTCTGG - Intergenic
939111128 2:138008607-138008629 TAGGTGTGCGGCCTTATTTCTGG - Intronic
939315583 2:140545593-140545615 TAGGTATGCAGCCTTATTTCTGG + Intronic
939484366 2:142791598-142791620 TAGGTTTGTGGCCTTGTTTCTGG - Intergenic
939782016 2:146460633-146460655 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
940081208 2:149803363-149803385 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
940456538 2:153908701-153908723 TAGGTGTGCAGCCTTAATTCTGG + Intronic
940464329 2:154009208-154009230 TAGGTGTGCAGCTTTATTTCTGG + Intronic
940611501 2:155998325-155998347 TAGGTATGCAGCTTTATTTCTGG - Intergenic
940615402 2:156043096-156043118 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
940615416 2:156043320-156043342 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
940708301 2:157131463-157131485 TAGGTGTGCAGCATTATTTCTGG - Intergenic
940812509 2:158261200-158261222 TAGGTGTGCATCCTTGTTTCTGG - Intronic
941034873 2:160557529-160557551 TAGATGTGCAGCCTTATTTCTGG - Intergenic
941194602 2:162433460-162433482 TAGGTGTGCAGCTTTATTTCTGG - Intronic
941861033 2:170280785-170280807 TAGGTGTGCGGCCTTATTTCTGG + Intronic
942400552 2:175597708-175597730 TAGGTGTGCACCTTTATTTCTGG + Intergenic
942581685 2:177425701-177425723 TAGGTGTGCAGTCTTATTTCTGG + Intronic
942719611 2:178936405-178936427 TAGGTTTGCGGCCTTATTTCTGG + Intronic
942741870 2:179190232-179190254 TAGGTATGTGACCTTATTTCTGG - Intronic
942835093 2:180285836-180285858 TAGGTATGCACCTTTATTTCTGG - Intergenic
942843120 2:180388563-180388585 TAGGTGTGCAGGCTTATTTCTGG + Intergenic
942886914 2:180937095-180937117 TATGTTGGCAACCTAGTCTCTGG - Intergenic
943071606 2:183147494-183147516 TAGGTGTGTGACTTTGTTTCTGG + Intronic
943155300 2:184167821-184167843 TAGGTGTGCAACTTTCTTTCTGG + Intergenic
943193286 2:184708479-184708501 TAGGTGTGCAGCTTTATTTCTGG - Intronic
943911098 2:193568938-193568960 TGGGTATGCAGCCTTATTTCTGG + Intergenic
943945097 2:194050884-194050906 TAGGTATGCACCTTTATTTCTGG - Intergenic
943986046 2:194620089-194620111 TAGGAGTGCAGCCTTATTTCTGG - Intergenic
944081196 2:195790522-195790544 TAGGTGTGCAGCTTTATTTCTGG - Intronic
944092586 2:195929554-195929576 TAGGTGTGCACCTTTATTTCTGG - Intronic
944335982 2:198535499-198535521 TAGGTGTGCAGCTTTATTTCTGG - Intronic
944774423 2:202948162-202948184 CAGGTGTGCAGCCTTGTTTCTGG + Intronic
944788696 2:203101308-203101330 TAGGTGTGCAGCATTATTTCTGG + Intronic
944942829 2:204649596-204649618 TAGGTGTGCAGCCCTATTTCTGG - Intronic
945015918 2:205516104-205516126 TAGGTGTGCACCCTTATTTCTGG + Intronic
945193131 2:207211020-207211042 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
945328196 2:208507757-208507779 TAGGTATGCAGCTTTATTTCTGG + Intronic
945346800 2:208727745-208727767 TAGGTGTGCAGCTTTATTTCCGG + Intronic
945347435 2:208734628-208734650 TAGGTATGCAACTTTATTTCTGG + Intronic
945487418 2:210413447-210413469 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
945578057 2:211556942-211556964 AAGGTATGCAGCCTTATTTCTGG - Intronic
945931669 2:215861389-215861411 TAGGATTGAAACTTTGTTTTAGG + Intergenic
947281130 2:228456239-228456261 TAGGTTAGCAGCATTATTTCTGG + Intergenic
948043557 2:234925007-234925029 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
948532830 2:238623383-238623405 TAGGTATGCATCTTTATTTCTGG - Intergenic
948954606 2:241278131-241278153 TCAGTTTGCAAGATTGTTTCAGG - Intronic
1168878671 20:1187559-1187581 TAGGTTGGCACCCTTGTTTGAGG - Intronic
1169179416 20:3550283-3550305 TAGGTGTGAAGCCTTATTTCTGG + Intronic
1170227562 20:14008798-14008820 TAGGTGTGCAGACTTATTTCTGG - Intronic
1170413757 20:16118475-16118497 TAGGTTTGTGATCTTATTTCTGG - Intergenic
1170699476 20:18690652-18690674 TAGGTGTGCAGCCTTATTTGTGG + Intronic
1171053015 20:21878608-21878630 TATGTGTGCAGCCTTATTTCTGG + Intergenic
1171287005 20:23948532-23948554 GAGGTATGCAGCCTTATTTCTGG + Intergenic
1171748089 20:29019485-29019507 TAGATGTGCAGCCTTGTTTCTGG - Intergenic
1171937701 20:31291457-31291479 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1172891128 20:38265809-38265831 TAGGTGTGCAGATTTGTTTCTGG - Intronic
1175462497 20:59162602-59162624 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1176317437 21:5260199-5260221 TAGATGTGCAGCCTTGTTTCTGG + Intergenic
1176349371 21:5779641-5779663 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1176356185 21:5900225-5900247 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1176543692 21:8177711-8177733 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1176562643 21:8360756-8360778 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1176779843 21:13181118-13181140 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1177320663 21:19515539-19515561 TAGGTTTGCAGCATTATTTCTGG - Intergenic
1177493300 21:21856194-21856216 TAGGTGGGCAGCCTTATTTCCGG + Intergenic
1177575105 21:22943952-22943974 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1177581812 21:23033197-23033219 TAGGTGTGCGGCCTTATTTCTGG + Intergenic
1177977492 21:27870145-27870167 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1179164225 21:38923560-38923582 TAAGTTTGCCACATTTTTTCAGG + Intergenic
1179256181 21:39717650-39717672 TAGATGTGCAGCCTTATTTCTGG + Intergenic
1179518025 21:41922892-41922914 AAGATTTGAAACATTGTTTCTGG - Intronic
1180193003 21:46176945-46176967 TAGGTGTGCAAACTTATTTCTGG - Intronic
1180395113 22:12324618-12324640 TAGATGTGCAGCCTTGTTTCTGG + Intergenic
1180404627 22:12540133-12540155 TAGATGTGCAGCCTTGTTTCTGG - Intergenic
1180592225 22:16950369-16950391 TAGGTATGCAGCTTTATTTCTGG - Intergenic
1182606303 22:31507187-31507209 TAGGTGTGCAGTCTTATTTCTGG - Intronic
1183067882 22:35376266-35376288 TAGGGTTTCAACCTTATTTATGG + Intergenic
1183878636 22:40806486-40806508 TAGGTTTTTAATCTTCTTTCTGG - Intronic
1184307097 22:43611992-43612014 TAGGTGTGCAGTCTTATTTCTGG - Intronic
1203248560 22_KI270733v1_random:93933-93955 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
949753967 3:7387596-7387618 TAGGTGTGCAGCTTTATTTCGGG + Intronic
950189005 3:10963523-10963545 TAGGCTTGAATCCTTGTTTCAGG - Intergenic
950292534 3:11797328-11797350 TAGGTGTGCAGCCTTATTTCCGG - Intronic
950588791 3:13919476-13919498 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
950608075 3:14102214-14102236 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
950947791 3:16968072-16968094 TAGGTATGCAGCATTATTTCTGG + Intronic
951567952 3:24030792-24030814 TAGGTGTGCAGCCGTGTTTATGG + Intergenic
951775244 3:26303095-26303117 TAGGTGTGGTACCTTATTTCTGG + Intergenic
951856056 3:27198465-27198487 TACGTGTGCAGCCTTATTTCTGG - Intronic
952019092 3:28995437-28995459 TAGGTGTGCAACTTTATTTCTGG + Intergenic
952026240 3:29086185-29086207 TACGTGTGCGGCCTTGTTTCTGG + Intergenic
952089940 3:29872899-29872921 TAGGTATGCAACCTTGTTTCTGG + Intronic
952127845 3:30322936-30322958 TAGTTGTGCGGCCTTGTTTCTGG - Intergenic
952141495 3:30483774-30483796 TAGGTGTGCAGCTTTGTTTCTGG - Intergenic
952205704 3:31180289-31180311 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
952228235 3:31401390-31401412 TAGGTGTGTGACCTTATTTCTGG + Intergenic
952474739 3:33696398-33696420 TAAGTTTAAAACCTTGTCTCTGG + Intronic
952562194 3:34608036-34608058 TAGGTGTGCAACTTTATTTTTGG + Intergenic
952642829 3:35618971-35618993 TAGGCATGCAGCCTTATTTCTGG - Intergenic
952809664 3:37390384-37390406 TAGGTATGCAGCCTTATTTCTGG + Intronic
952998997 3:38913802-38913824 TAGGTGTGCAGCCTTATTTCTGG + Intronic
953008827 3:39004330-39004352 TAGGTGTGCGGCCTTATTTCTGG + Intergenic
953087721 3:39688067-39688089 TAGGTTTGTAGATTTGTTTCTGG - Intergenic
953267492 3:41406277-41406299 TAGGTGTGCAGCTTTATTTCTGG + Intronic
953591628 3:44261465-44261487 TAGGTGTGCAGCCTTATTCCTGG + Intronic
955492233 3:59494541-59494563 TAGGTTGGCAGTCTTGTTTTTGG + Intergenic
955538087 3:59945837-59945859 TAGGTTTGCAGCTTTATTTCTGG + Intronic
955642257 3:61098258-61098280 TAGGTGTACAGCCTTATTTCTGG + Intronic
955752119 3:62194042-62194064 GAGGTTGGCAAACTTTTTTCTGG + Intronic
956016652 3:64890887-64890909 TAAATTTGCAACCTTGTTCCAGG + Intergenic
956859996 3:73313402-73313424 TAGGTATGCAGCATTATTTCTGG + Intergenic
957723660 3:84036488-84036510 TAGGTATGCAGTCTTATTTCTGG - Intergenic
957763324 3:84588434-84588456 TAGGTTTGTGATCTTATTTCTGG + Intergenic
958086059 3:88808957-88808979 TAATTTTGCAACATTGTTACTGG - Intergenic
958091828 3:88886414-88886436 TAGTTTTGCAGCTTTGATTCTGG + Intergenic
958268210 3:91465116-91465138 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
958589695 3:96139881-96139903 TAGGTATGCAGCCTTATTTCTGG - Intergenic
958937612 3:100273701-100273723 TAGGTGTGCAGTCTTATTTCTGG - Intronic
959045973 3:101474042-101474064 TAGGTATGCAGTCTTATTTCTGG + Intronic
959296073 3:104535797-104535819 TAGGTGTGTAGCCTTATTTCTGG - Intergenic
959301619 3:104609420-104609442 TAGGTGTGCAGACTTATTTCTGG - Intergenic
959326845 3:104947628-104947650 TAGGTGTGCAGCCTTATTTTTGG + Intergenic
959680264 3:109087908-109087930 TAGGTGTGCAGCCTTATTTCTGG - Intronic
959693285 3:109222399-109222421 TAGGTGTGCAGCTTTATTTCAGG - Intergenic
959753026 3:109860758-109860780 TAGGTGTGCAACTTTATTTCTGG - Intergenic
959783399 3:110264230-110264252 TTTTTTTACAACCTTGTTTCAGG + Intergenic
959788595 3:110330490-110330512 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
959789262 3:110337581-110337603 CAGGTGTGCAGCCTTATTTCAGG + Intergenic
959795104 3:110417532-110417554 TAGGTGTGCAACTTTATTTCTGG - Intergenic
959957676 3:112257381-112257403 TAGGTGTGCAGCCTTATTTCTGG - Intronic
960234657 3:115267919-115267941 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
960721679 3:120630456-120630478 TAGGTGTGCGGCCTTGTTTCTGG - Intronic
961932628 3:130549700-130549722 TAGGTGTGCAGCCTTATGTCTGG + Intergenic
962123690 3:132591314-132591336 TAGGTGAGCAGCCTTATTTCTGG + Intronic
962139015 3:132768349-132768371 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
962335206 3:134523698-134523720 CAGGTGTGCAGCCTTATTTCTGG + Intronic
962451627 3:135523197-135523219 TAGGTGTGCAACTTTACTTCTGG - Intergenic
962510041 3:136089391-136089413 TAGGTGTGCAGCTTTATTTCTGG + Intronic
962781165 3:138718853-138718875 TAGGTGTGCAGCCTTATTTCTGG + Intronic
962832255 3:139154389-139154411 TAGGTTTGCAGCATTATTTCTGG - Intronic
963259912 3:143181557-143181579 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
963295792 3:143544978-143545000 TAGGTGTGCAGCTTTATTTCCGG + Intronic
963632275 3:147748021-147748043 TAGGTGTGTGACCTTATTTCTGG + Intergenic
963685403 3:148427196-148427218 TAGGTGTGTGACCTTATTTCTGG + Intergenic
963831060 3:150009999-150010021 TAGGTGTGAGACCTTATTTCTGG - Intronic
964202466 3:154133519-154133541 TAGGTGTGCAGCCTTATTTCTGG + Intronic
964240048 3:154581971-154581993 TAGGTTTGCGGATTTGTTTCTGG + Intergenic
964255451 3:154770206-154770228 TAGATGTGCAGCCTTATTTCTGG + Intergenic
964375654 3:156046380-156046402 TAGGTGTGCAGCCTTATTTCTGG + Intronic
964435285 3:156644696-156644718 TTTGTTTTCAACCATGTTTCAGG - Intergenic
964498810 3:157325649-157325671 TAGGTGTGCAGTCTTATTTCTGG + Intronic
964511434 3:157456681-157456703 TAGGTGTGTAGCCTTATTTCTGG + Intronic
964511618 3:157458932-157458954 TAGGTGTGCAGCTTTATTTCTGG + Intronic
964593525 3:158395012-158395034 TAGGTGTGCAGCTTTATTTCTGG - Intronic
964690060 3:159440212-159440234 TAGGTATGCAGTCTTATTTCTGG + Intronic
965180490 3:165396393-165396415 TAGGTGTGCAGCATTATTTCTGG - Intergenic
965229644 3:166034111-166034133 TAGGTTTACTGCCTTATTTCTGG + Intergenic
965964543 3:174470778-174470800 TAGGTGTGCAGCTTTATTTCAGG + Intronic
965988415 3:174785451-174785473 TAGGTTTGCGACTTTATTTCTGG + Intronic
966270139 3:178095105-178095127 TAGGTGTGCAATCTTACTTCTGG - Intergenic
966320075 3:178692553-178692575 TAGGTGTGCAGCCTTATTTCTGG + Intronic
966353986 3:179059574-179059596 TAGTTTTACAGCCTTGATTCTGG - Intronic
966541203 3:181091792-181091814 TAGGAGTGCAGCATTGTTTCTGG + Intergenic
966644096 3:182223791-182223813 TAGGCGTGCAGCCTTATTTCTGG + Intergenic
966652558 3:182317207-182317229 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
966726190 3:183110948-183110970 TAGGTATGCAGCTTTATTTCTGG + Intronic
967508241 3:190278691-190278713 TAGGTGTGTGACCTTTTTTCTGG + Intergenic
967637839 3:191824974-191824996 TAGGTGTGTGACCTTGTTGCTGG - Intergenic
967702070 3:192604885-192604907 TAGGTGTGCAGCTTTATTTCTGG - Intronic
968260049 3:197314123-197314145 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
969700305 4:8764290-8764312 CAGGTTGGCAAACTTGTTGCTGG + Intergenic
970012647 4:11476802-11476824 TAGGTGTGCAGCCTTGTGTCTGG - Intergenic
970169071 4:13271143-13271165 TAGGTGTGTGACTTTGTTTCTGG + Intergenic
970248226 4:14086335-14086357 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
970329868 4:14969507-14969529 TAGGTTTGCAACCTCATTTGTGG - Intergenic
970593473 4:17578706-17578728 TAGGTTTGCTTCCTCATTTCTGG + Intronic
970678784 4:18483504-18483526 TAGGTATGCAGTCTTATTTCTGG + Intergenic
970836237 4:20410726-20410748 TAGGTGTGCAGTCTTATTTCTGG + Intronic
971656484 4:29352958-29352980 TAGGTATGCAACTTTATTTCTGG - Intergenic
971726699 4:30323607-30323629 TAGATATGCAGCTTTGTTTCTGG - Intergenic
971922931 4:32967466-32967488 TAGGTGTGCAACTTTATTTCTGG - Intergenic
972116121 4:35636366-35636388 TAGGTGCGCAGCCTTATTTCTGG - Intergenic
972177967 4:36430778-36430800 TAGGTGTGCAACATTATTTCTGG - Intergenic
972256592 4:37362501-37362523 TAGGTGTGCAGCTTTATTTCTGG - Intronic
972363774 4:38354081-38354103 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
972433655 4:39010599-39010621 TAGGTGTGCAGCTTTATTTCAGG - Intronic
972813840 4:42621912-42621934 TAGGTGTGCAGTCTTATTTCTGG - Intronic
972933085 4:44099295-44099317 TAGGTATGCTGCCTTATTTCTGG + Intergenic
972970182 4:44565247-44565269 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
973027309 4:45288784-45288806 TAGGTATGTGACCTTATTTCTGG + Intergenic
973151527 4:46894321-46894343 TAGGTGGGCAGCCTTATTTCTGG - Intronic
973470516 4:50802703-50802725 CAGGTTTGAAACATTCTTTCCGG + Intergenic
973767313 4:54174600-54174622 TAGGTGTGCAGCTTTATTTCTGG - Intronic
973853256 4:54983161-54983183 TAGGTGTGTAAATTTGTTTCTGG - Intergenic
974094498 4:57348257-57348279 TAGGTTTACAGCTTTATTTCTGG + Intergenic
974222404 4:58992790-58992812 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
974309874 4:60191450-60191472 TAGGTGTGAGACCTTATTTCAGG - Intergenic
974395671 4:61331610-61331632 TAGGCTTTCAAACTTGTTTGAGG + Intronic
974559917 4:63504386-63504408 TAGATGTGCAACTTTGTTTCTGG + Intergenic
974797464 4:66771350-66771372 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
975026453 4:69554937-69554959 TAGGTGTGCAACATTACTTCTGG - Intergenic
975105713 4:70566762-70566784 TATGTGTGCAGCCTTATTTCTGG + Intergenic
975107089 4:70579702-70579724 TAGGGGTGCAATCTTATTTCTGG - Intergenic
975299553 4:72774369-72774391 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
975304495 4:72833577-72833599 TAGATGTGCAGCCTTATTTCTGG + Intergenic
975390196 4:73807296-73807318 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
975396643 4:73882389-73882411 TATGTTTGCCAGATTGTTTCAGG + Intergenic
975652659 4:76609902-76609924 TAGATTTTCAAACTTGTCTCAGG + Intronic
975927743 4:79478681-79478703 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
976133530 4:81910440-81910462 TAAGTTTTCAACCCTTTTTCTGG - Intronic
976232673 4:82861426-82861448 TAGTTCTCCAACCTTGTTTCTGG - Intronic
976494367 4:85710188-85710210 TACGTGTGCGACCTTATTTCTGG - Intronic
976802259 4:89006217-89006239 TAGGTGTGCAGCCTTATTTCTGG + Intronic
976904215 4:90216579-90216601 TAGGTGTGTGACTTTGTTTCTGG + Intronic
977001997 4:91516516-91516538 TAAGTGTGCAGCCTTATTTCAGG + Intronic
977396319 4:96475992-96476014 TATGTGTGCAAATTTGTTTCTGG + Intergenic
977505618 4:97899653-97899675 TAGATGTGCAGCCTTATTTCTGG - Intronic
977742295 4:100501125-100501147 TAGCTTTATAACCTTATTTCAGG - Intronic
977752468 4:100625962-100625984 TAGGTGTGTGGCCTTGTTTCTGG - Intronic
977790584 4:101096425-101096447 GAGGTTTACAACCTTTTTGCTGG + Intronic
977956546 4:103034137-103034159 TAGGTGTGCAGTTTTGTTTCTGG - Intronic
977970983 4:103214123-103214145 TAGGTGTGTAGGCTTGTTTCTGG - Intergenic
978118906 4:105054609-105054631 TAGGTATGCAGTCTTATTTCTGG - Intergenic
978241004 4:106516439-106516461 TAGGTGTGCAGCCTAATTTCTGG + Intergenic
978286957 4:107090605-107090627 TAGGTGTGCAGCATTATTTCTGG - Intronic
978390280 4:108217961-108217983 TAGGTGTGCGGCCTTATTTCTGG + Intergenic
978601749 4:110435484-110435506 TAGGTGTGCAGCTTTATTTCTGG + Intronic
978709829 4:111766251-111766273 TAGATGTGCAACTTTCTTTCTGG + Intergenic
978923929 4:114219484-114219506 TAGGTGTGCAGCATTATTTCTGG - Intergenic
978952504 4:114577888-114577910 TAGGTGTGCAGCCTTGTTTCTGG + Intergenic
979012095 4:115385278-115385300 TAAGTGTGCAGCCTTATTTCTGG + Intergenic
979064420 4:116110548-116110570 TAGGTATGCAGCTTTATTTCTGG - Intergenic
979086409 4:116416074-116416096 TAGGTGTGCAGTCTTGTTTCTGG + Intergenic
979316534 4:119271597-119271619 TAGGTTTCCAACCTCGGTTCCGG - Exonic
979927761 4:126589129-126589151 TAGGTATGCAGCTTTATTTCTGG - Intergenic
979996586 4:127438912-127438934 TAGGTGTGCAGCCTTATTACTGG - Intergenic
980025288 4:127758780-127758802 TAGGTGTGTGGCCTTGTTTCTGG + Intronic
980257256 4:130398189-130398211 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
980288721 4:130815694-130815716 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
980398950 4:132254581-132254603 TAGGTATGCAGCCTTATTTCTGG + Intergenic
980477482 4:133336205-133336227 TAGGTGTGCAGACTTATTTCTGG + Intergenic
980514038 4:133830585-133830607 TAGGTGTGCAACTTTATTTATGG - Intergenic
980555518 4:134398441-134398463 TAGGTGTGCAGCATTATTTCTGG + Intergenic
980575147 4:134677840-134677862 TAGGTGTGCAACATTATTTCTGG + Intergenic
980609792 4:135144270-135144292 CAGGCATGCACCCTTGTTTCTGG + Intergenic
980647320 4:135659100-135659122 TAGGTGTGCAACCTTATTTCTGG + Intergenic
981154631 4:141419319-141419341 TAGGTTTGCAGATTTGTTTCTGG + Intergenic
981453661 4:144928909-144928931 TAGGTATGCAGCCTTATTTCCGG + Intergenic
981505296 4:145492817-145492839 TTGGGCTTCAACCTTGTTTCTGG - Intronic
981648108 4:147022834-147022856 TAGGTGTGCGGCCTTGTTTCTGG + Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982926877 4:161349115-161349137 CAGGTGTGCAGCCTTATTTCTGG + Intergenic
982994912 4:162330760-162330782 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
983125247 4:163943493-163943515 TAAGTGTGCAGCCTTATTTCTGG + Intronic
983233093 4:165149155-165149177 TAGGTGTGCAGTCTTATTTCTGG + Intronic
983303896 4:165961651-165961673 TAGGTATGCAGCTTTGTTTCTGG - Intronic
983407659 4:167350340-167350362 TAGGTGTGCAATTTTATTTCTGG + Intergenic
983439135 4:167758700-167758722 TAGGTATGCAGCATTATTTCTGG - Intergenic
983456946 4:167976997-167977019 TAGGTATGCAGCATTGTTTTGGG - Intergenic
983548104 4:168984743-168984765 TAGGTGTGCAGCTTTATTTCTGG - Intronic
983778142 4:171634180-171634202 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
983876993 4:172888566-172888588 TAGGCGTGCTACCTTATTTCTGG + Intronic
984023472 4:174515344-174515366 TAGGTGTACAGCCTTATTTCTGG - Intronic
984325476 4:178244502-178244524 TAGGTTTGCAGTCTTATTTCTGG + Intergenic
984386987 4:179073343-179073365 TAGGTGTGCAGGCTTGTGTCTGG - Intergenic
984661961 4:182383836-182383858 TAAGTGTGCAGCCTTATTTCTGG - Intronic
985356717 4:189127584-189127606 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
986195030 5:5530401-5530423 TAGGTGTGGGACCTTATTTCTGG + Intergenic
986532284 5:8750739-8750761 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
986655799 5:10010802-10010824 TAGGTGTGCAGCATTATTTCTGG - Intergenic
986878212 5:12137014-12137036 TAGGTGTGCAACATTATTTCTGG - Intergenic
986883407 5:12204135-12204157 TAGGTGTGCACCCTTATTTCTGG + Intergenic
986924349 5:12728852-12728874 TAGGTGTGCAACTTTATTTCTGG - Intergenic
987400822 5:17474672-17474694 TAGATGTGCAGCCTTATTTCTGG - Intergenic
987443063 5:17981599-17981621 TAGCTTTGCAACCTATTTTAGGG + Intergenic
987611832 5:20214518-20214540 TAGGTATGCAGCCTTATTTCTGG - Intronic
987896502 5:23953121-23953143 TAGGTGTGCAGACTTATTTCTGG + Intronic
988163177 5:27547810-27547832 TAGTTGTGCAGCCTTATTTCTGG - Intergenic
988294231 5:29334177-29334199 TAGTTTTGCACCCTTTTATCTGG + Intergenic
988630048 5:32919354-32919376 TAGGTGTGCAATCTTATTCCTGG - Intergenic
988966823 5:36427195-36427217 TAGGTGTGTGGCCTTGTTTCTGG + Intergenic
989299358 5:39870834-39870856 TAGGTGTGCAGCTTTATTTCAGG + Intergenic
989432121 5:41367949-41367971 TAGGTGTGCAGTCTTATTTCTGG + Intronic
989447731 5:41550428-41550450 TAGGTGTGCGACCTTATTTCAGG - Intergenic
989559375 5:42833702-42833724 TAGGTGTGCAGTCTTATTTCTGG - Intronic
990071965 5:51793436-51793458 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
990336819 5:54782039-54782061 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
990348617 5:54893253-54893275 TAGGTGTGCGGCCTTATTTCTGG - Intergenic
990360244 5:55011853-55011875 TAGGTGTGTAGCCTTATTTCTGG - Intronic
990525893 5:56627492-56627514 TAGCTGTGCAGCCTTATTTCTGG + Intergenic
990840343 5:60072802-60072824 TAGGTGTGCAGCCTTATTTCAGG + Intronic
990845876 5:60138094-60138116 TGGGTATGCAGTCTTGTTTCTGG + Intronic
991174571 5:63672084-63672106 TAGGTTTGTAACATTATTTCTGG - Intergenic
991417924 5:66410735-66410757 TAAGTTTGCAAACTTGTATGAGG - Intergenic
991526920 5:67569288-67569310 TAGGTGTGCAGAATTGTTTCTGG - Intergenic
991553936 5:67874268-67874290 ATGGTCTGCAACCTTGTTTAGGG + Intergenic
992265567 5:75014975-75014997 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
992922520 5:81541603-81541625 TAGGTCTGCAGCTTTTTTTCTGG - Intronic
993009435 5:82463312-82463334 TAGGTATGCAGCTTTATTTCTGG - Intergenic
993146714 5:84103051-84103073 TAGGTGTGCAACCTTATTTCTGG - Intronic
993178050 5:84514038-84514060 TAGGTGTGAAACCTTATTTCTGG + Intergenic
993286656 5:86007898-86007920 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
993362348 5:86993389-86993411 TAGGTGTGCAGCATTATTTCTGG + Intergenic
993702228 5:91132103-91132125 TAGGTGTGCAACTTTATTTTGGG + Intronic
993791307 5:92214924-92214946 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
993792728 5:92226609-92226631 TAGGTGTGCAACATTATTTGTGG + Intergenic
993972465 5:94436430-94436452 TAGGTGTGCGATCTTATTTCTGG + Intronic
994227465 5:97269685-97269707 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
994409109 5:99383939-99383961 TAGGTGTGTGGCCTTGTTTCTGG - Intergenic
994426835 5:99600481-99600503 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
994473119 5:100235115-100235137 TAGATGTGCAGCCTTATTTCCGG + Intergenic
994550858 5:101233111-101233133 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
994567499 5:101469668-101469690 TGGGTGTGCAACCTTATTTCTGG + Intergenic
994588050 5:101736439-101736461 TAGGTTTGCTGCCTTATTTCTGG - Intergenic
994598111 5:101865087-101865109 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
994620776 5:102159305-102159327 TAGGTGTGCGGCCTTATTTCAGG - Intergenic
994785129 5:104149865-104149887 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
994803815 5:104417088-104417110 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
994848054 5:105015971-105015993 TAGGTGTACAGCATTGTTTCTGG - Intergenic
995429310 5:112056566-112056588 TAGATGTGCAGCCTTATTTCTGG - Intergenic
995431154 5:112079224-112079246 TAGGTTTGTGGCCTTATTTCTGG + Intergenic
995664441 5:114525433-114525455 TAGGTATACAGTCTTGTTTCTGG - Intergenic
995733195 5:115268055-115268077 TAGGTTTGCAACCCTCATTAAGG + Intronic
996195047 5:120594789-120594811 TAGGTATGCAGCATTATTTCTGG - Intronic
996633255 5:125662736-125662758 TAGGTGTGCAACTTTATTTCTGG + Intergenic
996689314 5:126321270-126321292 TAGGTATGTGGCCTTGTTTCTGG + Intergenic
996787476 5:127255886-127255908 ATGGTTTACAACCTTGTTTGTGG + Intergenic
996902511 5:128558753-128558775 TAGGTGTGCTGCCTTATTTCTGG - Intronic
996991205 5:129634611-129634633 TAGGTTTGCAACCTTGTTTCTGG - Intronic
997017766 5:129956773-129956795 TAGGTTTGCAGCATTATTTCTGG + Intronic
997053202 5:130407725-130407747 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
997183544 5:131858268-131858290 TAGGTGTGCAGCTTTATTTCTGG - Intronic
997784054 5:136690733-136690755 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
998291380 5:140917703-140917725 TAGGTGTGCAGCTTTATTTCTGG + Intronic
998631678 5:143905457-143905479 TAGGTATGCAGCCTTATTTCTGG + Intergenic
998709585 5:144808281-144808303 TAGGTGTGCAGTATTGTTTCTGG - Intergenic
999057225 5:148591138-148591160 TAGATGTGCAGCCTTATTTCTGG + Intronic
999526829 5:152415616-152415638 TAGATGTGCAGCCTTATTTCTGG - Intronic
999593580 5:153176699-153176721 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
999659786 5:153848695-153848717 TAGGTTTGCGGCCTTATTTCTGG + Intergenic
1000165527 5:158644671-158644693 TAGGTGTGCTGCCTTATTTCTGG - Intergenic
1000435806 5:161207337-161207359 TAGGTGTGCAACTTTATTTCTGG - Intergenic
1001363746 5:171115784-171115806 TAGATTTTTAACTTTGTTTCTGG - Intronic
1001767700 5:174265493-174265515 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1003436906 6:6098980-6099002 TAGGAGTGCAGCCTTATTTCTGG + Intergenic
1003745875 6:9001452-9001474 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1004574220 6:16878022-16878044 TAGGTGTGAAGCCTTATTTCTGG + Intergenic
1004825841 6:19420135-19420157 CAGGTGTGCAGCCTTATTTCTGG + Intergenic
1004833696 6:19506544-19506566 TAGGTATGCAGTCTTTTTTCTGG + Intergenic
1004996385 6:21197661-21197683 TTGTTTTGCAACTTTGTTTCAGG + Intronic
1005702031 6:28411591-28411613 TAGGTATGCAGCCTTATTTCTGG + Intergenic
1005785222 6:29238090-29238112 TAGGTGTGCATTCTTATTTCTGG + Intergenic
1007027629 6:38593279-38593301 GAGGGTTGCAACATTGTTCCTGG - Intronic
1007121206 6:39383469-39383491 TAGGTGTGCAGCTTTATTTCAGG + Intronic
1007134118 6:39505181-39505203 TAGGTATGCAGTCTTATTTCTGG - Intronic
1007619418 6:43203047-43203069 AATTTTTCCAACCTTGTTTCTGG + Intronic
1008183246 6:48359974-48359996 TAGGTGTGCAATCTTATTTCTGG - Intergenic
1008335738 6:50302483-50302505 TAGGTGTGCAGTTTTGTTTCTGG + Intergenic
1008499575 6:52167536-52167558 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1008986994 6:57556470-57556492 TAGGTGTGCAGCCTTATTTCTGG - Intronic
1009037559 6:58135971-58135993 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1009060371 6:58391129-58391151 TAGGTCTGCAACTTTATTTCTGG - Intergenic
1009174949 6:60449028-60449050 TAGGTGTGCGGCCTTATTTCTGG - Intergenic
1009213346 6:60889599-60889621 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1009230541 6:61056206-61056228 TAGGTCGGCAACTTTATTTCTGG + Intergenic
1009263845 6:61529615-61529637 TAGGTATGCAGCCTTACTTCTGG - Intergenic
1009265676 6:61551672-61551694 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1009330561 6:62414513-62414535 TAAGTTTGCAACCTTAATTCTGG - Intergenic
1009597649 6:65755936-65755958 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1009672679 6:66776673-66776695 TAGGTACGCAGCCTTATTTCTGG - Intergenic
1009915641 6:69992207-69992229 TAGGTATGCATCTTTATTTCTGG + Intronic
1010328548 6:74593954-74593976 TATGTTTGCCACCATATTTCTGG + Intergenic
1010333197 6:74648254-74648276 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1010343009 6:74779451-74779473 TAGGTGTACAATCTTATTTCTGG + Intergenic
1010466289 6:76170460-76170482 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1010520107 6:76822268-76822290 TAGGTATGCAGTCTTATTTCTGG + Intergenic
1010675017 6:78733007-78733029 TAGCTGTGCAGCCTTGTTTCTGG - Intergenic
1010708152 6:79138889-79138911 TAGGTGTGCACCCTTATTTCTGG - Intergenic
1010948645 6:82008423-82008445 TAGGTATGCAGCATTATTTCTGG - Intergenic
1011105252 6:83772593-83772615 CAGGTGTGCAGCCTTATTTCTGG + Intergenic
1011500863 6:87988213-87988235 TAAGTGTGCAGCCTTATTTCTGG - Intergenic
1011922738 6:92601381-92601403 TAGGTGTACAGCCTTATTTCTGG - Intergenic
1011978146 6:93334088-93334110 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1012250894 6:96979447-96979469 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1012640145 6:101600209-101600231 TAGGTATGCAAGTTTATTTCTGG + Intronic
1012743819 6:103056545-103056567 TAGGTATGCAGCTTTATTTCTGG + Intergenic
1013022732 6:106235230-106235252 TAGCTTTACAACTTTGATTCTGG - Intronic
1013081165 6:106814592-106814614 TAGGTGTGCGGCCTTATTTCTGG - Intergenic
1013208415 6:107965321-107965343 TAGCTTTGTAACATTGTTGCAGG - Intergenic
1013314990 6:108932872-108932894 TAGGTATGCAGCCTTATTTCTGG + Intronic
1013991651 6:116260792-116260814 TAGGTGTGCAGTCTTATTTCTGG + Intronic
1014179477 6:118369257-118369279 TAGGTATGCAGCATTATTTCTGG - Intergenic
1014339962 6:120191965-120191987 CAGGTGTGCGACCTTATTTCTGG - Intergenic
1014432215 6:121384409-121384431 TAGGTTTGCCACCAGGTATCTGG - Intergenic
1014852332 6:126357238-126357260 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1014854642 6:126384458-126384480 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1014860909 6:126467324-126467346 GAGGTGTGCAGCCTTGTTTTTGG - Intergenic
1014961298 6:127688621-127688643 TAGGTGTGCAGCCTGATTTCTGG + Intergenic
1015247973 6:131096390-131096412 TAGGTGTGCAGCCTTAGTTCTGG - Intergenic
1015658149 6:135543166-135543188 TAGATATGCAGCCTTATTTCTGG - Intergenic
1016249687 6:142026099-142026121 TAGATTTGCAGCCTTATTTCTGG - Intergenic
1016423318 6:143908087-143908109 TAGGTGTGCAATCTTATTTCTGG + Intronic
1016453216 6:144205041-144205063 TAGGTGTACAGCCTTATTTCTGG + Intergenic
1016552973 6:145302515-145302537 TAGGTTCTCAGCATTGTTTCAGG + Intergenic
1016578425 6:145598915-145598937 TAGGTGTGCAGCCTTACTTCTGG + Intronic
1017342246 6:153337384-153337406 TAGGTGTGTAACTTTATTTCTGG + Intergenic
1017380512 6:153822963-153822985 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1017994100 6:159516511-159516533 TAGATATGCAGCCTTATTTCTGG + Intergenic
1018375345 6:163205396-163205418 TAGGTGTGCAGCCTTATTTCTGG - Intronic
1020342471 7:7127075-7127097 TAGGTGTGAACCCTTGGTTCTGG - Intergenic
1020551304 7:9608671-9608693 GAGGTGTGCAGCTTTGTTTCTGG - Intergenic
1020612435 7:10416200-10416222 AAGATTTGAAACTTTGTTTCAGG + Intergenic
1020651089 7:10877304-10877326 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1020702715 7:11503143-11503165 TAGATGTGCAACCTTATTTCTGG - Intronic
1020860601 7:13488268-13488290 TAGGTATGCAGTCTTATTTCTGG - Intergenic
1020940023 7:14521240-14521262 TAGGTGTGCAGCCTTACTTCTGG - Intronic
1021189890 7:17608041-17608063 TAGGTTTGCAGCTTTCTTTCTGG - Intergenic
1021426036 7:20500650-20500672 TAGGTATGTATCCTTATTTCTGG - Intergenic
1021976501 7:26016179-26016201 TAGGTGTGCGGCCTTATTTCTGG + Intergenic
1022247892 7:28578298-28578320 TAGGTTTTCATTCTTGCTTCTGG - Intronic
1022370600 7:29767670-29767692 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1022669682 7:32444084-32444106 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1022984807 7:35641649-35641671 TAGGTGTGCAGCCTTATTTCCGG - Intronic
1023084834 7:36560042-36560064 TAGGTGTGCTATCTTATTTCTGG + Intronic
1023234839 7:38074149-38074171 TAGGTGTACAGCCTTATTTCTGG + Intergenic
1024332159 7:48166512-48166534 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1024344928 7:48303642-48303664 TAGGTTTACGGCCTTATTTCTGG + Intronic
1024353008 7:48386568-48386590 TAGGTGTGCATTCTTATTTCTGG - Intronic
1024353420 7:48391041-48391063 TAGTTCTGCTTCCTTGTTTCAGG - Intronic
1024852137 7:53731127-53731149 TGGGTGTGCAGCCTTATTTCTGG + Intergenic
1024944286 7:54793049-54793071 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1024986360 7:55196823-55196845 TAGGTGTGCAGCCTTATTTCTGG + Intronic
1025621667 7:63177985-63178007 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1025715079 7:63948298-63948320 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1025866040 7:65381840-65381862 TAGGTGTGCCACATTATTTCTGG + Intronic
1027356938 7:77366540-77366562 TAGGTGTGCAGCCTTATTTCTGG + Intronic
1027554284 7:79643768-79643790 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1027578002 7:79955162-79955184 TAGGTATGCAGCTTTATTTCTGG - Intergenic
1027627060 7:80559260-80559282 TAGGTGTGCAATCTTATTTCTGG + Intronic
1027802873 7:82777579-82777601 TAGGTGTACAGCCTTATTTCTGG - Intronic
1027812415 7:82921426-82921448 TAGGTGTGCAACTTTATTTCTGG - Intronic
1028004817 7:85551697-85551719 TAGGTCTGCAGCATTATTTCTGG - Intergenic
1028176539 7:87666797-87666819 TAGGTGTGTAGCCTTATTTCTGG + Intronic
1028199675 7:87946660-87946682 GAGGTATGCAGCTTTGTTTCTGG + Intronic
1028389833 7:90302631-90302653 TAGGTGTGTAGCCTTATTTCTGG + Intronic
1028640268 7:93034597-93034619 TAGGTTTGTGGCCTTATTTCTGG - Intergenic
1028654473 7:93187747-93187769 TTGGATTGCAACCTTTTTTTTGG + Intergenic
1028969633 7:96843518-96843540 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1029063909 7:97828666-97828688 TAGGTGTGTGGCCTTGTTTCTGG - Intergenic
1030378749 7:108786620-108786642 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1030733864 7:113020825-113020847 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1030806551 7:113927196-113927218 TAGGTGTACAGCCTTATTTCTGG + Intronic
1031052734 7:116961119-116961141 TAGGTGTGCAGCATTATTTCTGG + Intronic
1031238075 7:119201942-119201964 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1031280030 7:119787550-119787572 TAAGGTTGCAACATTATTTCTGG + Intergenic
1031523579 7:122796546-122796568 TAGGTGTGCAGCCTTATTTCTGG - Intronic
1031751210 7:125577227-125577249 TAGGTATGCAGCCTTATTTCTGG - Intergenic
1031892939 7:127316076-127316098 TAGGTGTGCGGCCTTATTTCTGG - Intergenic
1031909610 7:127501603-127501625 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1032775204 7:135105541-135105563 TAGATGTGCAGCCTTATTTCTGG + Intronic
1032814869 7:135463037-135463059 TAGATGTGCAGCCTTATTTCTGG + Intronic
1032914562 7:136475050-136475072 TAGGTGTGTAGCCTTATTTCTGG + Intergenic
1033612588 7:142979551-142979573 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1033725551 7:144112577-144112599 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1034216582 7:149411996-149412018 TAGATGTGCAGCCTTATTTCTGG - Intergenic
1035473216 7:159124455-159124477 TAGGTGTGCAGCCTTATTTCTGG + Intronic
1036436628 8:8740572-8740594 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1036585943 8:10123806-10123828 TAGGTGTGCAACCTTATTTCTGG + Intronic
1036643895 8:10600559-10600581 TGGCTTTGCAGCCTTGTCTCAGG + Intergenic
1037313645 8:17581212-17581234 GGGGTTTGCTTCCTTGTTTCAGG - Intronic
1038477767 8:27880027-27880049 TAGGTGTGTAGCTTTGTTTCTGG - Intronic
1038562559 8:28593056-28593078 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1038960727 8:32516215-32516237 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1039289689 8:36080693-36080715 TAGGTGTGCAGCCTTACTTCTGG - Intergenic
1039897593 8:41727186-41727208 CAGGTGTACAACCTTGCTTCAGG - Intronic
1040350786 8:46565208-46565230 TAGGTGTGTGGCCTTGTTTCTGG - Intergenic
1040533516 8:48285482-48285504 TAGGTGTGCGGCCTTATTTCTGG - Intergenic
1040672621 8:49710973-49710995 TAGGTGTGTGACCTTGTTTCTGG - Intergenic
1040742708 8:50599173-50599195 TAGGTGTATAAACTTGTTTCTGG + Intronic
1040966748 8:53089844-53089866 TGGGTGTGCAACCTTATTTCTGG + Intergenic
1040986523 8:53300076-53300098 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1041521517 8:58761993-58762015 TAGGTGTGCGGCCTTATTTCTGG + Intergenic
1041655268 8:60343247-60343269 TAGGTGTGCAGCCTTATTTATGG - Intergenic
1041832645 8:62173021-62173043 TAGGTGTGCAGCTTTATTTCAGG + Intergenic
1042433748 8:68739935-68739957 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1042777884 8:72454628-72454650 TAGGTATGCAGCTTTATTTCTGG + Intergenic
1042851402 8:73219840-73219862 TAGGTGTGTAGCCTTATTTCTGG + Intergenic
1043034939 8:75184876-75184898 TAGGTGTGCAACTTTATTTCTGG - Intergenic
1043079405 8:75746832-75746854 TAGATTTGCAGCTTTATTTCTGG - Intergenic
1043237485 8:77886756-77886778 TAGGTGAGCAGCCTTATTTCTGG - Intergenic
1043281189 8:78468738-78468760 TAGATGTGCAACCTTATTTCTGG - Intergenic
1043681297 8:83028813-83028835 TAGGTGTGCGACCTTATTTCTGG - Intergenic
1043789003 8:84438892-84438914 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1044201232 8:89440572-89440594 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1044314740 8:90736882-90736904 TAGGTGTGCAGCCTTATTTTGGG - Intronic
1044315089 8:90740840-90740862 TAGGTGTGCAGCTTTATTTCAGG + Intronic
1044473382 8:92598467-92598489 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1044911431 8:97063776-97063798 TAGGTGTTCAGCCTTATTTCTGG + Intronic
1044952793 8:97450023-97450045 TAGGTTTTCAAGCTTGGTGCAGG + Intergenic
1045095759 8:98796325-98796347 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1045589121 8:103573527-103573549 TAGGTGTGCAGCTTTGTTTTTGG + Intronic
1045593934 8:103631440-103631462 TAGATGTGCAGCCTTATTTCTGG + Intronic
1045676179 8:104610201-104610223 TGGGTGTGCAGCCTTATTTCTGG + Intronic
1045729410 8:105217788-105217810 TAGTTTTGCAGCTTTATTTCTGG + Intronic
1046011425 8:108553022-108553044 TAGGTGTGAAGCCTTGTTTCTGG - Intergenic
1046139790 8:110076100-110076122 TAGATGTGCGACCTTCTTTCTGG + Intergenic
1046188798 8:110762075-110762097 TAGGTGTGCAGCCTTGTTTCTGG - Intergenic
1046458436 8:114501461-114501483 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1046524382 8:115365614-115365636 TAGTTATGCAGCCTTATTTCTGG + Intergenic
1046709499 8:117494184-117494206 TAGATGTGCAGCCTTATTTCTGG + Intergenic
1046838645 8:118831329-118831351 TAGGTGTGCCACTTTATTTCTGG - Intergenic
1046865267 8:119142298-119142320 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1047276727 8:123411187-123411209 TAGTTTTGCAGCTTTGATTCTGG - Intronic
1047699997 8:127439729-127439751 TAGGTGTGCAGCCTTATATCTGG - Intergenic
1048096793 8:131304579-131304601 TAGATGTCCAACCTTATTTCTGG - Intergenic
1048723117 8:137350086-137350108 TAGGTGTGCAGCCTTAATTCTGG + Intergenic
1048763263 8:137820263-137820285 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1049652776 8:143781631-143781653 TAGGTATGCAACCTTGTTTCTGG + Intergenic
1049943050 9:567152-567174 TAGGTATGCGGCCTTATTTCTGG + Intronic
1050177940 9:2888632-2888654 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1050425295 9:5506845-5506867 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1050475459 9:6035575-6035597 TAGGTGTGCAACCTTATTTCTGG - Intergenic
1050481590 9:6093370-6093392 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1050759325 9:9047579-9047601 TAGGTTTTCAGATTTGTTTCTGG - Intronic
1051456159 9:17260983-17261005 TAGGTGTGCAACTTTATTTCTGG + Intronic
1051575667 9:18612561-18612583 TAGGTGTGCAGTCTTATTTCTGG - Intronic
1051884536 9:21876674-21876696 TAGATGTGCAGCCTTATTTCTGG + Intronic
1051886640 9:21899861-21899883 TAGGTGTGCAGCTTTATTTCTGG - Intronic
1051914723 9:22194565-22194587 TAGGCTTGCAGTCTTATTTCTGG + Intergenic
1052100690 9:24442535-24442557 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1052281612 9:26739746-26739768 TAGGTGTGCAGCCTTACTTCTGG - Intergenic
1052377773 9:27737058-27737080 TAGATGTGCAGCCTTATTTCTGG + Intergenic
1052482268 9:29046431-29046453 TAGATGTGCAGCCTTATTTCTGG - Intergenic
1052634734 9:31087518-31087540 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1052707895 9:32015509-32015531 TAGGTATGCAGCTTTATTTCTGG + Intergenic
1052792920 9:32893681-32893703 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1053563977 9:39227885-39227907 TAGGTATGCAGCTTTATTTCTGG + Intronic
1053622885 9:39838607-39838629 TAGGTGTGCAACCTTATTTCTGG - Intergenic
1053890682 9:42689671-42689693 TAGGTGTGCAACCTTATTCTGGG - Intergenic
1054133171 9:61391159-61391181 TAGGTATGCAGCTTTATTTCTGG - Intergenic
1054221011 9:62412082-62412104 TAGGTGTGCAACCTTATTCTGGG + Intergenic
1054229703 9:62497090-62497112 TAGGTGTGCAACCTTATTCTGGG - Intergenic
1056146597 9:83737316-83737338 CAGGTGTGCAGCCTTATTTCTGG + Intergenic
1056556106 9:87689244-87689266 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1057638166 9:96790937-96790959 AAGGTGTGCAGCCTTATTTCTGG + Intergenic
1057732930 9:97627117-97627139 TTGGTTTTCAACTTTGTTTATGG + Intronic
1058196934 9:101988634-101988656 TAGGTGTTCAGCCTTATTTCTGG + Intergenic
1058199650 9:102023548-102023570 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1058403386 9:104642750-104642772 TAGGTGTGCAGCCTCATTTCTGG - Intergenic
1058467187 9:105241244-105241266 TAGCTCTGCAACTTTGTTTCTGG - Intergenic
1058517531 9:105791591-105791613 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1058665888 9:107315284-107315306 TAGGTATGCAGCTTTATTTCTGG + Intronic
1058716195 9:107723938-107723960 CAGATTTGCAAGCTTGTTTAGGG + Intergenic
1059017490 9:110535326-110535348 TAGGTGTGTGACCTTATTTCTGG + Intronic
1059807512 9:117818878-117818900 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1059913124 9:119068372-119068394 TAGGTGTGCAGCCTTGTTTCTGG + Intergenic
1060922513 9:127431890-127431912 GAGGTGTGCAACTTTATTTCCGG + Intronic
1203464961 Un_GL000220v1:77181-77203 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1203410284 Un_KI270581v1:2044-2066 TAGATGTGCAGCCTTGTTTCTGG - Intergenic
1203415699 Un_KI270582v1:5246-5268 TAGATGTGCAGCCTTGTTTCTGG + Intergenic
1187756209 X:22529758-22529780 TAAGTGTGCAGCCTTATTTCTGG - Intergenic
1188027303 X:25223615-25223637 TAGATGTGCAGCCTTATTTCTGG + Intergenic
1188080796 X:25837948-25837970 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1188087515 X:25919010-25919032 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1188139359 X:26529382-26529404 TAGGTGTGCAGCCATATTTCTGG - Intergenic
1188155332 X:26734960-26734982 TAGGTGTGAAGCCTTATTTCTGG + Intergenic
1188172664 X:26947180-26947202 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1188221165 X:27543292-27543314 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1188315921 X:28673177-28673199 TAGCTGTGCAGCCTTATTTCCGG - Intronic
1188713089 X:33426101-33426123 TAGGTGTGCTGCCTTATTTCTGG + Intergenic
1188771040 X:34154850-34154872 TAGGTTTGCAGCATTATTTCTGG + Intergenic
1188796790 X:34476845-34476867 TAGGTTTGCAGAATTATTTCCGG + Intergenic
1188799134 X:34505188-34505210 TAAGTTTGCAGCTTTATTTCTGG + Intergenic
1188810472 X:34648372-34648394 TAAGTGTGCAGCCTTATTTCTGG - Intronic
1188854932 X:35182309-35182331 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1188888292 X:35577835-35577857 TAAGTGTGCAGCATTGTTTCTGG - Intergenic
1188959642 X:36475050-36475072 TAGGTGTGCAACGTTATTTCTGG - Intergenic
1189154466 X:38742933-38742955 TAGGTCTGCAACTTTATTTCTGG + Intergenic
1189188856 X:39078414-39078436 TAGGTGTGCAGCCATATTTCTGG + Intergenic
1189190713 X:39101067-39101089 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1189582466 X:42421577-42421599 TAGGTATGCAGCCTGATTTCTGG - Intergenic
1189644376 X:43110738-43110760 TAGTGGTGCTACCTTGTTTCTGG - Intergenic
1189659460 X:43281131-43281153 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1189855422 X:45219534-45219556 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1189861576 X:45277314-45277336 TAGGTGTGCACCTTTGTTTCTGG + Intergenic
1189893156 X:45626718-45626740 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1189895663 X:45653325-45653347 TAGGTTTACAGCCTTATTTCTGG + Intergenic
1190515319 X:51217950-51217972 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1190532015 X:51387774-51387796 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1190810259 X:53876388-53876410 TAGGTGTGCAGCCTTATCTCTGG + Intergenic
1190880502 X:54488731-54488753 TAGGTGTGCGGCCTTATTTCTGG - Intronic
1190958210 X:55218372-55218394 GAGGTTTGCAGCATTATTTCTGG + Intronic
1191162355 X:57343919-57343941 TAGGTTTGCAGCTTTATTTCTGG + Intronic
1191630879 X:63320730-63320752 TAGGTCTGCAGTCTTATTTCTGG - Intergenic
1191703395 X:64066834-64066856 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1191738464 X:64412197-64412219 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1191760166 X:64638289-64638311 TAGGTATGCAACTTTATTTCTGG + Intergenic
1191816081 X:65246592-65246614 CAGGTGTGCAATCTTATTTCTGG - Intergenic
1191822011 X:65320729-65320751 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1191824032 X:65344402-65344424 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1192011907 X:67282688-67282710 TAGGTTTGCGGTCTTATTTCTGG - Intergenic
1192253845 X:69437919-69437941 TAGATGTGCAGCCTTATTTCTGG + Intergenic
1192296575 X:69855624-69855646 TAGGTGTGCGGCCTTATTTCTGG + Intronic
1192527077 X:71856238-71856260 TAGGTGTGCGGCCTTATTTCTGG + Intergenic
1192604495 X:72501452-72501474 TAGGTGTGCAGCCTTATTTCTGG - Intronic
1192685256 X:73297930-73297952 TAGGTGTGTGACCTTATTTCTGG - Intergenic
1192723092 X:73720890-73720912 TAGGTGTGCAATCTTATTTCTGG + Intergenic
1192870769 X:75181163-75181185 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1192892337 X:75404058-75404080 TAGATGTGCAGCCTTATTTCTGG - Intronic
1192966995 X:76187920-76187942 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1193073127 X:77327708-77327730 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1193094564 X:77532474-77532496 TAGGTGTGCAGTCTTATTTCTGG - Intronic
1193100722 X:77608419-77608441 TAGGTGTGTGAACTTGTTTCTGG - Intronic
1193160501 X:78223448-78223470 TAGATACGCAGCCTTGTTTCTGG - Intergenic
1193229327 X:79025423-79025445 TAGGTGTGCAGCATTATTTCTGG - Intergenic
1193270376 X:79522434-79522456 TAGGTGTGCAAATTTATTTCTGG - Intergenic
1193397080 X:80998103-80998125 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1193417896 X:81246615-81246637 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1193448756 X:81640515-81640537 TAGGCATGCAGCTTTGTTTCTGG + Intergenic
1193494413 X:82193023-82193045 TAGGTATGCAGCCTTATTACTGG + Intergenic
1193499351 X:82255264-82255286 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1193523715 X:82562705-82562727 TAGGTGTACAGCCTTATTTCTGG - Intergenic
1193563720 X:83051871-83051893 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1193649659 X:84114790-84114812 TAGGTATGCAGCTTTATTTCTGG - Intronic
1193664918 X:84304295-84304317 TAGGTGTGCAGATTTGTTTCTGG - Intergenic
1193672646 X:84408358-84408380 TAGGTATGCAGCTTTATTTCTGG + Intronic
1193674421 X:84432144-84432166 TAGGTATGCAACATTATTTCCGG + Intronic
1193675026 X:84439709-84439731 AAGGTGTGCAGCTTTGTTTCTGG + Intronic
1193708206 X:84848877-84848899 TAGGTGTGCAGCCTTGTTTCTGG - Intergenic
1193711028 X:84880137-84880159 TAGGTGTGCAGCCTTATTTCTGG + Intergenic
1193754352 X:85388866-85388888 TAGGTGTGCGGCCTTATTTCTGG - Intergenic
1193805531 X:85989180-85989202 TAGGTGGGCAACCTTATTTCTGG - Intronic
1193812485 X:86068090-86068112 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1193920337 X:87417214-87417236 TAGGTGTTCAGCCTTATTTCTGG + Intergenic
1193940582 X:87676994-87677016 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1193946903 X:87749082-87749104 TAGGTTTTCTTCCTGGTTTCTGG - Intergenic
1194055133 X:89122588-89122610 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1194129903 X:90068823-90068845 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1194134063 X:90116996-90117018 TAGGTGGGCAGCCTTATTTCTGG - Intergenic
1194320833 X:92443838-92443860 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1194333164 X:92610904-92610926 TAGGTGTGCAACTTTATTTCTGG + Intronic
1194394116 X:93359158-93359180 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1194446804 X:93997786-93997808 TTGGTGTGCAGCCTTATTTCTGG + Intergenic
1194470213 X:94285104-94285126 CAAGTTTGCAACCTCCTTTCAGG - Intergenic
1194521821 X:94928820-94928842 TAGGTGTGTAAATTTGTTTCTGG + Intergenic
1194559321 X:95401425-95401447 TAGATGTGCAGCCTTATTTCTGG - Intergenic
1194593407 X:95829515-95829537 TAGGTGTGCAGCTTTATTTCTGG - Intergenic
1194593547 X:95831142-95831164 AAGGTGTGCAGCCTTATTTCTGG + Intergenic
1194630932 X:96282670-96282692 TAGGTGTGCAGCCTTATTTCTGG - Intergenic
1195021483 X:100832991-100833013 TAGGTTTGCAAGCATCTTTAAGG + Intronic
1195103247 X:101576560-101576582 TAGGTGTGCAGCTTTGTTTCTGG + Intergenic
1195160881 X:102169843-102169865 TAGGTGTGTAGCCTTATTTCTGG + Intergenic
1195270558 X:103225129-103225151 TAGGTATGCAGTCTTATTTCTGG - Intergenic
1195500282 X:105589687-105589709 TAGGTATGCAGCTTTATTTCTGG + Intronic
1195586581 X:106571897-106571919 TAAGTGTGCGACCTTATTTCTGG - Intergenic
1195610305 X:106859018-106859040 TAGGTGTGCAGCTTTATTTCTGG + Intronic
1196014998 X:110929869-110929891 TAGGTGTGCAATCTTATTTCTGG - Intergenic
1196052179 X:111317257-111317279 TAGGTTTGTGGCCTTATTTCTGG - Intronic
1196069161 X:111500268-111500290 TTGGGTTGCCAACTTGTTTCAGG - Intergenic
1196332410 X:114487623-114487645 TAGGTGTGCAATCTTATTTCTGG + Intergenic
1196487853 X:116234470-116234492 TAGGTGTGCATCCTTATTCCTGG + Intergenic
1196523978 X:116709029-116709051 TAAGTATGCAGCCTTATTTCTGG + Intergenic
1196550992 X:117024798-117024820 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1196579202 X:117359839-117359861 TAGGTGTGCTGCCTTATTTCTGG - Intergenic
1196874161 X:120142459-120142481 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1196949450 X:120862183-120862205 TAGATGTGCAGCCTTATTTCTGG + Intergenic
1197030264 X:121804087-121804109 TAGGTATGTGACCTTATTTCTGG + Intergenic
1197166708 X:123385308-123385330 TAGGTGTGCAACCTTATTTCTGG + Intronic
1197242844 X:124138062-124138084 TAGGTGTGCAGCCCTATTTCTGG + Intronic
1197356442 X:125441713-125441735 TAGGTGAGCAGCTTTGTTTCTGG + Intergenic
1197497263 X:127200231-127200253 TAGGTGTGCAGCTTTATTTCTGG + Intergenic
1197600670 X:128524374-128524396 TAGGTATGCAGATTTGTTTCTGG - Intergenic
1197926302 X:131650016-131650038 TAGGTGTGTGACCTTATTTCTGG + Intergenic
1197970053 X:132105691-132105713 TAGTTGTGCAGCCTTATTTCTGG - Intronic
1198032049 X:132762654-132762676 TATGTCTGAAAGCTTGTTTCTGG - Intronic
1198794002 X:140376489-140376511 TATGTGAGCAGCCTTGTTTCTGG - Intergenic
1198960651 X:142179045-142179067 TAGGTGTGCAGTCTTATTTCTGG + Intergenic
1199146728 X:144377757-144377779 TAGGTATGCAGCCTTATATCTGG + Intergenic
1199150658 X:144481643-144481665 TAGGTGTGCAGCATTATTTCTGG + Intergenic
1199183248 X:144883387-144883409 TAGGTGTGCAACCTTAGTGCTGG - Intergenic
1199218831 X:145293470-145293492 TAGGTTTGAATCCTGGCTTCGGG - Intergenic
1199306629 X:146274684-146274706 TAGGTGTGTAGCCTTGTTTCTGG + Intergenic
1199322731 X:146460276-146460298 TAGGTGTGCAAGTTTATTTCTGG - Intergenic
1199379926 X:147158506-147158528 TAGGTGTACAGCCTTATTTCTGG - Intergenic
1199479141 X:148278547-148278569 TAGGTGTGCAGTCTTATTTCTGG - Intergenic
1199706693 X:150432724-150432746 TAAGTGTGCAACATTATTTCCGG + Intronic
1199739866 X:150724887-150724909 TAGGTGTGCACCCTTATTTCTGG + Intronic
1200035475 X:153325881-153325903 TAGGTGTGCAGACTTATTTCTGG + Intergenic
1200340886 X:155394398-155394420 TAGGTGTGTGACCTTATTTCTGG - Intergenic
1200479842 Y:3687111-3687133 TAGGTGGGCAGCCTTATTTCTGG - Intergenic
1200628947 Y:5556974-5556996 TAGGTATGCAGCTTTATTTCTGG + Intronic
1200641849 Y:5729929-5729951 TAGGTGTGCAACTTTATTTCTGG + Intronic
1201222213 Y:11782648-11782670 TAGGTGTGCATCTTTATTTCTGG - Intergenic
1201348902 Y:13016875-13016897 TAGGTGTGCAACTTTATTTCTGG + Intergenic
1201399418 Y:13588056-13588078 TAGGTGTGCAGCCTCATTTCTGG - Intergenic
1201991164 Y:20028260-20028282 TAGTTTTGCAGCTTTATTTCTGG - Intergenic
1202300683 Y:23410556-23410578 TAGGTGTGCAACCTTATTTCAGG + Intergenic
1202570128 Y:26260042-26260064 TAGGTGTGCAACCTTATTTCAGG - Intergenic