ID: 996993301

View in Genome Browser
Species Human (GRCh38)
Location 5:129663569-129663591
Sequence CTTAGTAACCAAAAGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996993301_996993303 10 Left 996993301 5:129663569-129663591 CCCACTTTCTTTTGGTTACTAAG 0: 1
1: 0
2: 3
3: 46
4: 471
Right 996993303 5:129663602-129663624 TTTTTCTACAGAGTATCTTCTGG 0: 1
1: 0
2: 2
3: 32
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996993301 Original CRISPR CTTAGTAACCAAAAGAAAGT GGG (reversed) Intronic
903880245 1:26503252-26503274 CTTACCAACCAAAACAAAGAGGG - Intergenic
904345836 1:29868604-29868626 GCTAGCAACCAAAAGCAAGTGGG - Intergenic
905168319 1:36096505-36096527 CTTATTAAGGAAAAGGAAGTGGG + Exonic
905612728 1:39368818-39368840 AATAGTAACTAATAGAAAGTAGG + Intronic
906031559 1:42724341-42724363 AATAATAACCAAAAGAAAGCAGG + Intergenic
906230664 1:44160528-44160550 AATAGTAAACAAAAGAGAGTGGG - Intergenic
906873290 1:49508456-49508478 TTCATTAACCAAAATAAAGTAGG + Intronic
906937576 1:50227375-50227397 AAGAGTAACCAAGAGAAAGTGGG - Intergenic
907234571 1:53033803-53033825 ATATGTAACCAAAAGAAATTAGG + Intronic
907603105 1:55789631-55789653 CTGAATCACCAAAAGCAAGTTGG - Intergenic
907690716 1:56662717-56662739 ATGAGTAACTAAAAGAAAATAGG + Intronic
908394176 1:63710123-63710145 AATATTAACCAAAAGAAAGCAGG + Intergenic
908962739 1:69719368-69719390 CTTAAAAACAAAAAGAATGTGGG - Intronic
909160266 1:72138544-72138566 AATACTAATCAAAAGAAAGTTGG + Intronic
910545840 1:88417059-88417081 AATAGTAACCAAAAAAAAGCAGG + Intergenic
910821560 1:91355538-91355560 AATAGTAACCAAAAGAGAGCAGG + Intronic
911668351 1:100581098-100581120 CTTAGAAACCAAAACACACTGGG + Intergenic
912634224 1:111276832-111276854 ATCACTAACCAAAAGAAAGTAGG - Intergenic
912973200 1:114303740-114303762 CTTTTTAACAAAAAGAGAGTAGG + Intergenic
913189025 1:116397774-116397796 CTTTGTAAACAAAACAAAGAAGG - Intronic
913584570 1:120261377-120261399 CTTTGTGACCTAAAGATAGTGGG + Intergenic
913623613 1:120636982-120637004 CTTTGTGACCTAAAGATAGTGGG - Intergenic
914314033 1:146491991-146492013 CATCGTAATCAAAAGAAAATTGG - Intergenic
914500314 1:148241389-148241411 CATCGTAATCAAAAGAAAATTGG + Intergenic
914566566 1:148873233-148873255 CTTTGTGACCTAAAGATAGTGGG + Intronic
914606253 1:149257007-149257029 CTTTGTGACCTAAAGATAGTGGG - Intergenic
915528804 1:156491643-156491665 CTCAGTAACCACAAGCAGGTGGG - Intronic
915701056 1:157797293-157797315 CTTAGTAGCCAGAGGAAAATTGG + Intronic
916254919 1:162777664-162777686 CTTATTAACCAGAAGAATTTGGG + Intronic
917410456 1:174755199-174755221 ATTACTAACCAAAAAGAAGTTGG - Intronic
917698053 1:177549674-177549696 AATAGTATCCAAAAGAAAGCTGG - Intergenic
918224061 1:182463477-182463499 AATAGTAACCAAAAGAAAGCAGG + Intronic
918326496 1:183416346-183416368 CTTTGGAACCAAGAGAAAGGAGG - Intronic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
918670069 1:187203901-187203923 CTTAGGAAGAAAAAGAAGGTGGG - Intergenic
918751402 1:188275366-188275388 TTTAGTTACCAAAAGCTAGTTGG - Intergenic
919293931 1:195669866-195669888 CTTAGCAAAAAGAAGAAAGTTGG - Intergenic
919585031 1:199426933-199426955 AATAATAACCAAAAGAAAGCAGG + Intergenic
922687347 1:227652271-227652293 AATAGTAACCAAATGATAGTTGG - Intronic
923420920 1:233814057-233814079 AGTAGTAAGAAAAAGAAAGTTGG - Intergenic
923703609 1:236324157-236324179 AATAGTAACCAAAAGAGAGTAGG + Intergenic
924361937 1:243250554-243250576 CTGATTAACCAATAAAAAGTTGG - Intronic
924389272 1:243534207-243534229 CATAGTAATTTAAAGAAAGTGGG + Intronic
924397256 1:243634629-243634651 CATAGTAACCAAAAGAGAAAAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924675588 1:246174108-246174130 CTTATTAAAAAAAATAAAGTTGG - Intronic
924716882 1:246583728-246583750 CTTTGTAACCAAAAGCCACTTGG - Intronic
924757332 1:246953320-246953342 CTCAGTAATAAAAACAAAGTGGG + Intronic
1066007719 10:31162544-31162566 AATAGTAACCAAAAGAAAACAGG - Intergenic
1066684417 10:37967012-37967034 AGTAGTAACCAAAAGAGAGCTGG + Intronic
1067244796 10:44530566-44530588 AATAGTAACCAAAAGAGAGCAGG - Intergenic
1067452254 10:46389106-46389128 CTTAGTAGCCAAAGAAAACTTGG - Intronic
1067584983 10:47470649-47470671 CTTAGTAGCCAAAGAAAACTTGG + Intronic
1069329918 10:67279651-67279673 CTTAGGAACAAAAGGAAAGGCGG + Intronic
1071023469 10:81084394-81084416 AATAGTAACCAAAAGATAGCAGG - Intergenic
1071462139 10:85908801-85908823 TATAGTAATCAAAAGAATGTCGG + Intronic
1071612367 10:87043214-87043236 AATAGTAACCAAAAGAGAGCTGG - Intergenic
1072123165 10:92421599-92421621 ATTAGTAACAGAAAGACAGTTGG + Intergenic
1072753501 10:98001009-98001031 AATACTAACCAAAAGAAAGCTGG + Intronic
1072814650 10:98493610-98493632 AATAGTAACCAAAAGAGAGTAGG - Intronic
1074149779 10:110748223-110748245 TTTGCTAACCAAAAGAATGTGGG + Intronic
1074802010 10:117009477-117009499 ATTAGTAACCAAAAGAGAGTTGG + Intronic
1077448909 11:2622366-2622388 AATAGTAACCTAAAGAAAGCTGG - Intronic
1078135725 11:8650065-8650087 CTTTGTAACCAAAAGAACAGTGG + Intronic
1078332132 11:10431752-10431774 AACAGTAACCAAAAGAAAGCTGG + Intronic
1078633063 11:13022567-13022589 AATAGTAACCAAAAGAGAGCTGG - Intergenic
1079118647 11:17659294-17659316 CATAGTAACCAAGAGAAAGCTGG + Intergenic
1080316206 11:30952055-30952077 AATAATAACCAAAAGAAAGTTGG + Intronic
1080466817 11:32505191-32505213 CTTAGTTACCAGGAGAAAGTGGG + Intergenic
1082945277 11:58751440-58751462 CTTACTAGCCAGAAGAGAGTGGG + Intergenic
1083042449 11:59700835-59700857 GATAGTAACCAAAAGTAAGTAGG - Intergenic
1084897227 11:72282069-72282091 AATAGTAACCAAAAGAGAGCAGG - Intergenic
1085186754 11:74582245-74582267 CTCAGTTACCAAAACTAAGTGGG - Intronic
1085941486 11:81210933-81210955 CTTAGTAATCAATAGCAAGTGGG - Intergenic
1086026291 11:82296292-82296314 AATAGTAACCAAAAGAGAGAAGG - Intergenic
1086074716 11:82837855-82837877 CTTAGTAACTAAAACAAAGCTGG + Intronic
1086366732 11:86114521-86114543 TTTACTAATCAAAAGAAAGCTGG - Intergenic
1087331000 11:96780094-96780116 AATACTAATCAAAAGAAAGTTGG + Intergenic
1087422402 11:97946208-97946230 ATTACTAACCAAAAGAAAGTTGG + Intergenic
1088029870 11:105235206-105235228 ATCAATAACCAAAAGACAGTTGG + Intergenic
1088461598 11:110089115-110089137 CTTTGTAACCAAAAAAGATTTGG + Intergenic
1089211523 11:116807116-116807138 AATAGTAATCAAAAGAAAGCAGG + Intergenic
1089766228 11:120767988-120768010 CTGAGAAAGAAAAAGAAAGTTGG - Intronic
1090213986 11:124944128-124944150 CTTAGTAAGCAAGGGAAACTGGG + Intergenic
1090476165 11:127022773-127022795 CTTAGTAATCACAAAAAAATTGG + Intergenic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1090822724 11:130358424-130358446 AATAGTAATCAAAAGAAAGCTGG - Intergenic
1091029182 11:132169050-132169072 ATTAGAAACCAAAAGAAGGAGGG - Intronic
1091072005 11:132575073-132575095 AATGGTAACCAAAAGAAAGCAGG - Intronic
1091578707 12:1765897-1765919 CTGAGTACCTGAAAGAAAGTTGG - Intronic
1091707510 12:2707220-2707242 AATAGTAACCAAAAGAGAGCAGG + Intergenic
1092037660 12:5352504-5352526 ATCAGTAACCAAAAGAAAACTGG + Intergenic
1092292933 12:7174786-7174808 CTCAGTAACTATAAGAATGTGGG - Intergenic
1092620210 12:10256129-10256151 AAGAGTAACCAAAAGAAATTGGG - Intergenic
1092951712 12:13509758-13509780 CTGAGAAACCAAAGGAAAGCTGG + Intergenic
1093033783 12:14314035-14314057 CTCAGTACCCAAGAGAAAGGTGG + Intergenic
1093327582 12:17797429-17797451 CTTACAACCCAAAAGAAATTAGG + Intergenic
1093590020 12:20891348-20891370 CTTACAAGCCAAAAGAAATTAGG - Intronic
1094755052 12:33458637-33458659 AATAGTAATCAAAAGAAAGCAGG + Intergenic
1095713150 12:45311818-45311840 CTTGGTAACTGATAGAAAGTGGG + Intronic
1097455895 12:59797699-59797721 CCTACAAACCAAAAGAGAGTGGG + Intergenic
1098539380 12:71636771-71636793 CCAAGTAACCAGAAAAAAGTAGG + Intronic
1098613292 12:72488330-72488352 AATTGTAACCAAAAGAAAGCAGG + Intronic
1099396187 12:82143855-82143877 CTTAGTAAGAACTAGAAAGTTGG + Intergenic
1101418641 12:104530822-104530844 CTTCTGAACCAAAAGAAACTTGG - Intronic
1101990687 12:109482032-109482054 TTTTATAACCAAAAAAAAGTTGG - Intronic
1102306661 12:111810005-111810027 CTCAATAACCAAAGGAAGGTGGG + Intergenic
1103162756 12:118743852-118743874 CACAGTAACGAAACGAAAGTAGG + Intergenic
1104166652 12:126237812-126237834 AACATTAACCAAAAGAAAGTTGG - Intergenic
1104275943 12:127328011-127328033 TTGAGTGACCAAAAGAAGGTGGG - Intergenic
1104496251 12:129242433-129242455 AATTCTAACCAAAAGAAAGTTGG - Intronic
1104680204 12:130745373-130745395 CTTAGTAATAGAAAGAAACTAGG - Intergenic
1105738933 13:23301516-23301538 AATGCTAACCAAAAGAAAGTAGG + Intronic
1108989491 13:56637479-56637501 CTTATTAAAAAAAAGAAAATAGG - Intergenic
1109883681 13:68513768-68513790 CTTAATAACCAAGAGATAGTGGG - Intergenic
1111418847 13:87983633-87983655 CTTAGGAACAAAATGAAAGCAGG - Intergenic
1112534808 13:100242237-100242259 AATAGTAACCAAAAGAGAGCTGG + Intronic
1112586756 13:100725444-100725466 GTTCATAACCAAAAGAAAGGAGG + Intergenic
1112853988 13:103743263-103743285 ATTAGTGACCATAAGAATGTGGG + Intergenic
1113612929 13:111660717-111660739 TTTGGTAATTAAAAGAAAGTTGG + Intronic
1114572132 14:23678709-23678731 ATTGTTAACCAAAAGAAAGCTGG + Intergenic
1115135182 14:30099223-30099245 CTTACAAACCAGAAGAGAGTGGG + Intronic
1115398814 14:32937046-32937068 CTTAGTAACAAAATCAAAGAAGG - Intronic
1116031685 14:39580537-39580559 CTTATTTAGCAAAAGAAAGAAGG - Intergenic
1116224675 14:42134528-42134550 CTTAGTAACTAACTGAATGTTGG - Intergenic
1116513464 14:45776401-45776423 AATAGTAACCAAAAGAGAGCAGG - Intergenic
1116979927 14:51157948-51157970 CTTAGGAACCTCAAGACAGTAGG - Intergenic
1117645138 14:57843593-57843615 CCTGGAAACCAAGAGAAAGTTGG - Intronic
1117655652 14:57953101-57953123 CTTACGAACCAGAAGAGAGTGGG + Intronic
1118149051 14:63168610-63168632 AATAGAAACCAAAAGAAAGCAGG + Intergenic
1118750078 14:68799749-68799771 AATAGTAACCAAAAGAGAGCAGG - Intergenic
1119004878 14:70915439-70915461 TTTAGTAACCAAAATATATTTGG + Intronic
1119482718 14:74968876-74968898 CTTTTAAACAAAAAGAAAGTGGG - Intergenic
1119581557 14:75787328-75787350 AGTACTAACCAGAAGAAAGTTGG + Intronic
1120015995 14:79474093-79474115 ATTTGAAACCAAAAAAAAGTTGG + Intronic
1120065932 14:80040613-80040635 CTTAGAAGCCAGAAGAGAGTGGG + Intergenic
1120175680 14:81290813-81290835 CTTGGTAACTAAAAGAGAGTTGG - Intronic
1120453664 14:84703588-84703610 CTTAGGAACCTACAGAAAGAGGG - Intergenic
1121135024 14:91489217-91489239 CTTAGTGATGAAAACAAAGTTGG + Intronic
1122571558 14:102706391-102706413 AGTAGTAACCAAAAGAAAGCAGG + Intronic
1125052599 15:35318216-35318238 AATATTAAGCAAAAGAAAGTTGG + Intronic
1125090874 15:35791143-35791165 CTTAAAGACCAAAAGAAAATGGG - Intergenic
1125839064 15:42781130-42781152 TGTACTACCCAAAAGAAAGTTGG + Intronic
1126523090 15:49619326-49619348 ATTTGTAAGCAAAAGAAAGTGGG + Intronic
1126653632 15:50952705-50952727 CATAAAAACCAAAAGAAAGTGGG - Intronic
1126959899 15:53980077-53980099 CTTTTTAATCATAAGAAAGTGGG - Intergenic
1127325178 15:57887975-57887997 CTTATGAACAAAAAGGAAGTAGG - Intergenic
1127452388 15:59129867-59129889 CCTACAAGCCAAAAGAAAGTGGG - Intergenic
1127636384 15:60874647-60874669 CTTAATCACCAAAACTAAGTAGG + Intronic
1128190574 15:65690934-65690956 CTCAGCAACCAAAAGAGAGAGGG + Exonic
1129978782 15:79847176-79847198 TTCAGAAACCAAAAGAAAGGTGG + Intronic
1130213897 15:81950850-81950872 CTTTGAAACCAAAAAAAACTAGG - Intergenic
1130219336 15:82005570-82005592 CTTAGTAGCAAAAATAAACTGGG + Intergenic
1131069629 15:89457794-89457816 CTTACACACCAAAAAAAAGTTGG - Intergenic
1131722100 15:95180736-95180758 ATTTGAAACAAAAAGAAAGTAGG + Intergenic
1132159168 15:99521268-99521290 AATACTAATCAAAAGAAAGTTGG - Intergenic
1134663350 16:16000769-16000791 CTTAACAACCAAAACAAAGGAGG + Intronic
1136055578 16:27686402-27686424 AATACTAACCAAAAGAAAGCCGG - Intronic
1137900911 16:52267840-52267862 CTTAGTAAGCACAGGAAAATAGG - Intergenic
1137990547 16:53149911-53149933 AATAGTAACCAAAAGAGAGCTGG - Intronic
1138702671 16:58880564-58880586 CTTAGTAAAAAAAAAAAGGTGGG + Intergenic
1139443650 16:66982714-66982736 AACAGTAACCACAAGAAAGTTGG - Intergenic
1140337771 16:74125813-74125835 AATACTAACCAGAAGAAAGTTGG + Intergenic
1143286519 17:5793919-5793941 CTTAGTAACCAACAAAAACTTGG - Intronic
1144263596 17:13547058-13547080 TTTAATAGCCAAAAGAAATTTGG - Intronic
1147170930 17:38618396-38618418 CTTAGTAAACAAAAGCATGTGGG - Intergenic
1148169483 17:45507298-45507320 ATTAGTGAGCAAAAGAAAATAGG - Intergenic
1148365869 17:47055365-47055387 ATTAGTGAGCAAAAGAAAATAGG + Intergenic
1149130770 17:53298601-53298623 ATAAGTAACCAAAAGAGAGCAGG + Intergenic
1150400672 17:64853785-64853807 ATTAGTGAGCAAAAGAAAATAGG - Intergenic
1152282956 17:79396164-79396186 GGTGGTAACCAAAAGAAGGTGGG - Intronic
1152619232 17:81353193-81353215 ATTAGAAAAAAAAAGAAAGTGGG - Intergenic
1153176303 18:2377515-2377537 CTTACTAACCAAAAGAAGTAGGG + Intergenic
1153441960 18:5130481-5130503 CATAGTAACCAAAAGAGCATGGG + Intergenic
1153607655 18:6850762-6850784 GTTAGGAAAGAAAAGAAAGTGGG + Intronic
1154938545 18:21087496-21087518 AATATTAATCAAAAGAAAGTGGG + Intronic
1155418197 18:25624497-25624519 TATAATAACCAAAAGAGAGTGGG - Intergenic
1155863878 18:30940038-30940060 AATGGTAACCAAAAGAAAGTGGG - Intergenic
1156342766 18:36226339-36226361 AATGGTAACCAAAAGAGAGTAGG - Intronic
1156348161 18:36277116-36277138 AATACTAACCAAAAGAAAGCTGG + Intergenic
1156380525 18:36555857-36555879 ATTGCTAATCAAAAGAAAGTTGG - Intronic
1156423588 18:36983277-36983299 AATAGTAACCAAAAGAAAGCTGG + Intronic
1156741421 18:40334241-40334263 CATAGTAACCAAAAGAGAGCAGG - Intergenic
1156842428 18:41625295-41625317 CTTAGTATCCAAAATAAAAATGG + Intergenic
1157178668 18:45476308-45476330 CTTACAAACCAGAAGAGAGTGGG - Intronic
1158150755 18:54366979-54367001 AGTGGTAACCAAAAGGAAGTAGG - Intronic
1158663654 18:59412821-59412843 CCTAGGAACCAAAATAAAGGAGG - Intergenic
1159736852 18:72110594-72110616 CTTAGTAAAGAAAAGATAGGAGG - Intergenic
1163998321 19:21073464-21073486 GATAGTAACCAAAAGAGAGCTGG - Intergenic
1164774168 19:30838493-30838515 ATTATAAACCCAAAGAAAGTAGG + Intergenic
1164946735 19:32301141-32301163 AATGGTAACCAAAAGAAAGCAGG - Intergenic
1165273219 19:34727955-34727977 CTTAGTGACCACAGGAATGTGGG + Intergenic
1165298622 19:34951139-34951161 AATAGTAACCAAAAGAAAGCAGG + Intergenic
924967245 2:90395-90417 AACAGTAACCAAAAGAAAGCTGG + Intergenic
925281521 2:2688597-2688619 CTGAGAAACCGAGAGAAAGTAGG - Intergenic
926772620 2:16392012-16392034 ATTAGAAACCACAAGAAAGACGG - Intergenic
926909088 2:17833140-17833162 CTTTTAAACCAAAAGAAAGTAGG + Intergenic
928191268 2:29171404-29171426 ATACTTAACCAAAAGAAAGTTGG - Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
931451958 2:62375468-62375490 TGTAGTAACCAAAACAACGTGGG + Intergenic
931641788 2:64386894-64386916 CTTAGGAACAAAAGGAAAGGCGG - Intergenic
931766773 2:65463829-65463851 CCTTGTAACAAAGAGAAAGTAGG - Intergenic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
932425101 2:71627900-71627922 AATACTAACCAAAAGAAAGCTGG - Intronic
932561060 2:72869956-72869978 AATAGTAACCAAAAGAGAGCAGG + Intergenic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
933578278 2:84094561-84094583 AATAGTAACCCAAAGAAAGCTGG + Intergenic
935041226 2:99429593-99429615 AGTAGGAACCAAAAGAAATTGGG - Intronic
935846446 2:107170727-107170749 CTTTATAACTAAAAGAAACTAGG + Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936607988 2:113976685-113976707 CTCCCTAACCAAAAGGAAGTTGG - Intergenic
936892380 2:117387561-117387583 CATGGAAACCAAAAGCAAGTGGG - Intergenic
937199898 2:120194853-120194875 AATAGTAACCAAAAGAGAGCAGG + Intergenic
937545504 2:123013152-123013174 AATAGTAACCAAAAGATAGAAGG + Intergenic
937698778 2:124839688-124839710 CTTATAAACCAAAACACAGTGGG + Intronic
937793088 2:125983365-125983387 CTTAGAAACAAAAATAAACTGGG - Intergenic
938154305 2:128918289-128918311 AATAGTAACCCAAAGAGAGTGGG - Intergenic
938215450 2:129509053-129509075 CTTAATAACCAAAGGCAAGGTGG + Intergenic
938224106 2:129600907-129600929 CTTACAAGCCAGAAGAAAGTGGG - Intergenic
938255190 2:129853254-129853276 AATAGTAACCAAAAGAGAGCTGG + Intergenic
938622918 2:133076021-133076043 AATACTAATCAAAAGAAAGTTGG + Intronic
939368908 2:141272639-141272661 AATAGCAACCATAAGAAAGTTGG + Intronic
939686955 2:145212155-145212177 CCTACAAACCAGAAGAAAGTGGG - Intergenic
939789733 2:146556812-146556834 CATAGAAAGCAAAATAAAGTGGG + Intergenic
940084111 2:149838777-149838799 CTTACAAGCCAAAAGATAGTGGG - Intergenic
940131206 2:150384982-150385004 AATAGAAACCAAAAGCAAGTAGG - Intergenic
940198462 2:151123076-151123098 CTTTGTCTCCAAAAGAAAGGGGG + Intergenic
940212615 2:151271143-151271165 TTTAGTGACCAAATGAATGTTGG + Intronic
940991535 2:160102446-160102468 CATAGTAAGCAAAAGACAGCTGG - Intronic
941051555 2:160739880-160739902 CTTAATAAGCTAAAGAAAATAGG - Intergenic
941117823 2:161491889-161491911 CATAGTAACAAAAAAAAAATGGG + Intronic
941171644 2:162145360-162145382 CTTAGTACCAAAAACAAAATGGG + Intronic
941248883 2:163136385-163136407 CTTTGTCACCAACAGAAATTAGG + Intergenic
941833569 2:169991035-169991057 AATAGTAACCAAAAGAGAGCTGG + Intronic
942271587 2:174280981-174281003 CTTAGTTAGAAAAAGAAAGAAGG - Intergenic
942505713 2:176639132-176639154 CTTAGAAATGAGAAGAAAGTGGG - Intergenic
943449495 2:188030654-188030676 CTTCATAACCAAAAAAAAATGGG + Intergenic
943867264 2:192941643-192941665 AATAGCAACCAAAAGAAAGCTGG - Intergenic
944073469 2:195700038-195700060 AATAGTAACCAAAAGAGAGCAGG - Intronic
944201012 2:197107493-197107515 CTTACTAACTAAAAAAGAGTGGG + Intronic
944264898 2:197712576-197712598 TATATTAACCAAAAGAAAGCTGG + Intronic
944432726 2:199652034-199652056 AATGGTAACCAAAAGAAAGCAGG - Intergenic
945202778 2:207300290-207300312 AATAGTAACCACAAGAAAGCTGG + Intergenic
946066614 2:216993170-216993192 CTTAGAAGCAAAAATAAAGTTGG - Intergenic
947126147 2:226870359-226870381 TTTAGAAAGCAAAAGAAATTAGG - Intronic
947172695 2:227326466-227326488 CTTTGAAACCAAAAGATAGAAGG - Intronic
947276690 2:228400126-228400148 CTTAGAAGCCAAAAGAGATTAGG - Intergenic
947401841 2:229739073-229739095 AATAGTAACCAAAAGAGAGCAGG + Intergenic
948071531 2:235131697-235131719 CTTTGTAACCAATACAAAGTAGG + Intergenic
948324461 2:237102082-237102104 AATACTAACCAAAAGAAAGTTGG + Intergenic
1169750577 20:8988732-8988754 TTTAGTAACCAAAAAAGAGAAGG + Intergenic
1169823247 20:9737322-9737344 AGAACTAACCAAAAGAAAGTTGG + Intronic
1170183818 20:13564637-13564659 CTTGGAAACAAAAAAAAAGTTGG + Intronic
1171080948 20:22183878-22183900 AATAGTAACCAGAAGAGAGTTGG - Intergenic
1171197648 20:23212849-23212871 CTTAGGAACAAAAAGATGGTGGG - Intergenic
1171441587 20:25167738-25167760 CTTACAAACCAGAAGAAAGTGGG + Intergenic
1173544425 20:43883172-43883194 CTCCCTACCCAAAAGAAAGTTGG + Intergenic
1174286456 20:49477461-49477483 CTCAGAAAAAAAAAGAAAGTGGG + Intronic
1175368099 20:58469249-58469271 TTTAGTAAATAAAAGCAAGTTGG + Intronic
1175826094 20:61937443-61937465 TTTATTAAGAAAAAGAAAGTGGG + Exonic
1177869373 21:26552315-26552337 AATATTAACCAAAAGAAAGCTGG - Intronic
1177875809 21:26630184-26630206 AATAGTAACCAAAAGAGAGCTGG - Intergenic
1182685205 22:32117314-32117336 CATGATAACCAAAAGACAGTTGG + Intergenic
1185412706 22:50694064-50694086 AATAGTAACCAAAAGAGAGCTGG - Intergenic
949386166 3:3504649-3504671 CTTAAAGGCCAAAAGAAAGTTGG - Intergenic
950324994 3:12098887-12098909 AATAGTAACCAAAAGAGAGTTGG + Intronic
950697191 3:14711481-14711503 AATTGTAACCAAAAGACAGTAGG - Intronic
950740512 3:15047408-15047430 CTTAATATCCAAAACTAAGTGGG + Exonic
951010198 3:17668820-17668842 CTTCGTAAGCCACAGAAAGTGGG - Intronic
951223685 3:20096190-20096212 CTAAGTTACCAAAATAAATTTGG - Intronic
951285345 3:20805446-20805468 AATGCTAACCAAAAGAAAGTTGG + Intergenic
951433273 3:22632891-22632913 CTTAGGAATGAAATGAAAGTGGG - Intergenic
951463605 3:22977646-22977668 CTCAGTAAATAAAAGACAGTTGG + Intergenic
951829359 3:26907248-26907270 CTTACTAACCAAATGACATTTGG - Intergenic
951881871 3:27487408-27487430 CATAGTAACAAGAACAAAGTAGG + Intergenic
952067325 3:29586560-29586582 CTTAGTAATCAAATGGAACTAGG + Intronic
952245359 3:31583546-31583568 AATAGTAACCAAAAGAGAGCAGG - Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
955764494 3:62327383-62327405 CTTAGTAAGAAAAAGAATATGGG - Intronic
956317576 3:67955685-67955707 CTTAATAACCAATAGAAAAATGG - Intergenic
956480025 3:69664024-69664046 ATTAGTTACCAGAAGAAAATAGG - Intergenic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956832856 3:73070379-73070401 TTTAGTAAACAAAATTAAGTGGG - Intergenic
956942950 3:74185025-74185047 ATTAGTAACCATAAGAAAGAAGG - Intergenic
956993461 3:74796025-74796047 CTTACAAACCAGAAGAGAGTGGG + Intergenic
957221413 3:77387680-77387702 CTTAGGAACAAAAGGAAAGGCGG - Intronic
957535608 3:81499101-81499123 CTTACTTACCAAAAGAGAATAGG + Exonic
957827671 3:85469570-85469592 CTTTGTAAGCAAGAGAAAGGGGG + Intronic
958796048 3:98707581-98707603 CTCAGTTACCAATAGAAAATAGG + Intergenic
958890422 3:99776545-99776567 CTTTGTAAGCAAAAAAAATTAGG + Intronic
959304639 3:104645689-104645711 CTTAGTAACTTAAAGAAATTAGG - Intergenic
959327507 3:104956276-104956298 CTAAGTAACCTAAGGAAAGAAGG + Intergenic
960144316 3:114183741-114183763 AATAGTAACCAAAAGAGAGCAGG - Intronic
960540436 3:118855603-118855625 CCTAGTAACCAACACACAGTGGG - Intergenic
961639268 3:128354757-128354779 TTTTATAACCAAAAGAAAGGAGG + Intronic
961994511 3:131227828-131227850 GTTAGTAACTAGAATAAAGTTGG - Intronic
962261493 3:133911609-133911631 TTGAAAAACCAAAAGAAAGTAGG - Intergenic
962560113 3:136597286-136597308 CTTAGTAAAGAAAAGAAAGAAGG + Intronic
963095072 3:141528001-141528023 CAAAGTATTCAAAAGAAAGTTGG + Intronic
963997514 3:151727229-151727251 CTTAATAACAAAAAGAAAACTGG - Intergenic
965082889 3:164057681-164057703 AATAGTAACCAAAAGAAAGGAGG - Intergenic
965791515 3:172393210-172393232 AATAGAAACCAAAAGAAAGCAGG + Intronic
965967479 3:174511476-174511498 ATCACTAACCAAAAGAAAGCTGG - Intronic
966499559 3:180624240-180624262 CATGGAAACCAAAAGCAAGTAGG - Intronic
966545651 3:181144227-181144249 AATATTAATCAAAAGAAAGTGGG + Intergenic
967222860 3:187262830-187262852 CTGAGAAACCCAAAGAAAGGAGG + Intronic
967474227 3:189896836-189896858 CATAGAAACCACTAGAAAGTGGG + Exonic
967927881 3:194666324-194666346 ATAAGTAACCAAAATAAAATAGG + Intronic
968792329 4:2675050-2675072 ATCAGTAACAAAAAGATAGTTGG - Intronic
969104215 4:4792838-4792860 CTAAGAAAGAAAAAGAAAGTAGG - Intergenic
970347853 4:15170841-15170863 AGCAGGAACCAAAAGAAAGTAGG + Intergenic
970437651 4:16050977-16050999 GATAGTAAACAAAATAAAGTAGG + Intronic
970544855 4:17117463-17117485 AACAGTAATCAAAAGAAAGTAGG + Intergenic
970573803 4:17407963-17407985 CATAGTGACCAAAAGAAGATAGG - Intergenic
971662511 4:29438164-29438186 CTCAGTAAGGAAAATAAAGTAGG - Intergenic
972356193 4:38281134-38281156 CCCAGGAACCAAAAGAAAGCAGG - Intergenic
972965470 4:44503679-44503701 AATCATAACCAAAAGAAAGTTGG + Intergenic
973043859 4:45510328-45510350 AATAGTAACCAAAAGAGAGGAGG - Intergenic
973938177 4:55872789-55872811 CACAGGAACCGAAAGAAAGTAGG - Intronic
974369903 4:61002266-61002288 AATAGTAACCAAAAGAAAGCAGG + Intergenic
975200920 4:71588221-71588243 ATTGGTAGCTAAAAGAAAGTGGG - Intergenic
976588937 4:86829737-86829759 CTTAGTAAAAAAAAAAAACTAGG - Intronic
977086961 4:92612411-92612433 CTCAATAACCAAAAATAAGTCGG - Intronic
977812201 4:101369720-101369742 AATACTAATCAAAAGAAAGTGGG + Intergenic
977846254 4:101771451-101771473 CTTACAAGCCAAAAGAAATTGGG - Intronic
978139265 4:105298865-105298887 CCTACAAACCAGAAGAAAGTGGG + Intergenic
978758000 4:112324957-112324979 CTGAGGAACCAAAAAAAAGGGGG + Intronic
979207706 4:118060370-118060392 AATAGTAATCAAAAGAAAGCTGG - Intronic
979464802 4:121023624-121023646 ATTACTAATCTAAAGAAAGTTGG + Intergenic
980508360 4:133753534-133753556 AACACTAACCAAAAGAAAGTTGG - Intergenic
980560970 4:134475337-134475359 CTGAGCAACAAAAAGAAAGCCGG + Intergenic
980581016 4:134750382-134750404 CATTATAACCAAAAGAAAGGAGG + Intergenic
981653790 4:147089175-147089197 CTTAATAACCAAATAAAAATGGG + Intergenic
982050071 4:151491821-151491843 CATAGAAACCAAAAGCAAGCAGG + Intronic
982347186 4:154372948-154372970 CTTAGTAACCACCAGCAAATGGG + Intronic
982394810 4:154904739-154904761 TTTTGTAACAAAAAAAAAGTGGG + Intergenic
982532321 4:156560553-156560575 AATGGTAACCAAAAGAAAGCAGG - Intergenic
982681752 4:158439519-158439541 CTTAGTCCCTAAAAGAGAGTTGG - Intronic
983753748 4:171307779-171307801 CATAGTTACCAAAAGTAAGAAGG - Intergenic
984394297 4:179175121-179175143 ATTACTAACCAAAAGAGAGCAGG - Intergenic
984426150 4:179588682-179588704 ATTAATAATCAAAATAAAGTGGG - Intergenic
985518581 5:359524-359546 ATTAGTACCAAAAACAAAGTAGG + Intronic
986239617 5:5947807-5947829 ATTAATAACAAAAAGAAATTTGG - Intergenic
986462934 5:7991627-7991649 TCTAGTAACCAAAAGGAATTTGG - Intergenic
987214979 5:15726177-15726199 AATAGTAACCAAAAAAGAGTGGG - Intronic
987418605 5:17691744-17691766 CTGAGCAACTAAAAAAAAGTAGG + Intergenic
987626743 5:20412144-20412166 CATAGTAACCAAAACAACATGGG + Intronic
988222953 5:28372903-28372925 AATAATAACCAAAAGAAAGCAGG + Intergenic
989392694 5:40918617-40918639 AATAGAAACCAAAAGAAAGCAGG + Intronic
990034256 5:51300407-51300429 ATTATTACCCAAAAAAAAGTTGG + Intergenic
990172694 5:53071710-53071732 CTAAGAAACCAAAAGAGACTTGG - Intronic
990255005 5:53958738-53958760 CATAGTGACCAAAAAACAGTTGG + Intronic
990314129 5:54568138-54568160 TTTAGAAACCAAGGGAAAGTGGG - Intergenic
990499632 5:56382964-56382986 AATACTAACCAAAAGAAAGAAGG + Intergenic
990590287 5:57255701-57255723 CTTAGTAGCAAAAAAACAGTTGG + Intronic
991966695 5:72098689-72098711 GTTAGTATACAAAAGAAAGGAGG + Intergenic
992038256 5:72803013-72803035 ATAATTAACCAAAAGAAAGTAGG - Intergenic
992209182 5:74460910-74460932 CTCAAAAACCAAAAGGAAGTTGG + Intergenic
992292156 5:75290978-75291000 CCTACTAGCCAGAAGAAAGTGGG - Intergenic
992308610 5:75469890-75469912 ACTAGAAACCAAAAGACAGTAGG + Intronic
992925150 5:81575802-81575824 GACATTAACCAAAAGAAAGTTGG + Intronic
992991362 5:82287091-82287113 CATAGTAACCCAAAGATAGCAGG - Intronic
993404407 5:87493401-87493423 AGTAGTAAACAAAAGAAAGCAGG - Intergenic
993671578 5:90766904-90766926 TTTAATAATCAAAAGAAGGTGGG + Intronic
994267375 5:97734139-97734161 CTTAGTAACAAAAAGAACTTTGG - Intergenic
995041508 5:107593462-107593484 CTTAGGAACCATAAGCAGGTTGG - Intronic
995587739 5:113665865-113665887 AATGGAAACCAAAAGAAAGTAGG + Intergenic
995620805 5:114023062-114023084 CCTAGAAGCCAGAAGAAAGTGGG + Intergenic
995656419 5:114432390-114432412 AATACTAATCAAAAGAAAGTTGG - Intronic
996137239 5:119858602-119858624 CATAGAAACCAAAAGAGAGCAGG - Intergenic
996319528 5:122199002-122199024 TTAAGAAATCAAAAGAAAGTTGG - Intergenic
996667931 5:126082257-126082279 ATTGGTAACCAAAAGAGAGCAGG + Intergenic
996696321 5:126399793-126399815 AATGGTAACCAAAAGAAAGCAGG - Intronic
996924374 5:128806821-128806843 AATACTAATCAAAAGAAAGTGGG - Intronic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
997664454 5:135618234-135618256 AATAGAAACCAAAAGTAAGTAGG - Intergenic
999469591 5:151841205-151841227 ATCAATAACCAAAAGAAAGTTGG + Intronic
1000366135 5:160493037-160493059 CCCTCTAACCAAAAGAAAGTGGG - Intergenic
1002768979 6:272230-272252 AATAGTAACCAAAAGAGAGCTGG - Intergenic
1005895624 6:30175055-30175077 TTTAGAAGCCAAAAGAAATTTGG + Intergenic
1007534491 6:42573647-42573669 TTTTGTACCTAAAAGAAAGTAGG + Intronic
1007873908 6:45072756-45072778 CTTGGTAACACAAAGAAAGATGG - Intronic
1008224496 6:48897467-48897489 CAGAGTAATCAAAAGACAGTTGG - Intergenic
1008637185 6:53422653-53422675 CTTAGAAAGTAAAACAAAGTTGG - Intergenic
1008653333 6:53585879-53585901 CTGATGAACCAAAAGAAATTAGG - Intronic
1008657197 6:53627925-53627947 GGCAGTAACCAAAATAAAGTGGG + Intergenic
1009491548 6:64298857-64298879 AATAGTAACCAAAAGAGATTAGG + Intronic
1009858393 6:69293276-69293298 CTTAATAAGTAAGAGAAAGTGGG - Intronic
1010081003 6:71862469-71862491 ATTACTAATCAAAAGAAAGTGGG - Intergenic
1010338487 6:74719446-74719468 AATAGTAACCAAAAGAGAGCAGG - Intergenic
1010892272 6:81327696-81327718 CTTAGCAACCAAAAGAAGTTGGG - Intergenic
1011174293 6:84542632-84542654 CTTACAAACCAGAAGAGAGTGGG + Intergenic
1011354908 6:86464075-86464097 CTTAGTAAACTGAATAAAGTAGG - Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1012675945 6:102113541-102113563 CTTAGAAACCAGAAGAGACTGGG - Intergenic
1012704555 6:102504885-102504907 CATAGTAGCCAAAAGAAAGCAGG - Intergenic
1013187211 6:107770183-107770205 CTTAGTTGGCAAAATAAAGTTGG - Intronic
1013704099 6:112812382-112812404 TCTAGTAAACAAAAGAAAGCTGG - Intergenic
1014375521 6:120667625-120667647 CTTAATAACCACAATCAAGTAGG - Intergenic
1014589020 6:123238772-123238794 AATATTAACCAAAAGAAAGCTGG + Intronic
1015785088 6:136915037-136915059 TTTAAGAACCAAAAAAAAGTGGG - Intergenic
1015852212 6:137585813-137585835 ATCAATAACCAAAAGATAGTTGG - Intergenic
1015991393 6:138947752-138947774 ACTAGTAACCGAAAGAAAATAGG - Intronic
1016629940 6:146216887-146216909 CTTAGAAACCCAAACCAAGTTGG - Intronic
1016698481 6:147026524-147026546 ATTAGTAACCAAAAAAAGGTTGG + Intergenic
1017308725 6:152951990-152952012 CTTAGAAACCAAAACAAATGAGG + Intergenic
1017352377 6:153457778-153457800 CTTATAAGCCAAAAGAGAGTGGG - Intergenic
1018165736 6:161093751-161093773 TCTAGAAACCAAAAGAAAATGGG - Exonic
1018319339 6:162590441-162590463 CTTAATAAAAAAAAGAAAGATGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1018649694 6:165982924-165982946 CTTTGTAACTTAAAGAAAATTGG - Intronic
1020519395 7:9167685-9167707 CCTAGAAACCAGAAGAGAGTGGG - Intergenic
1020971384 7:14945333-14945355 GGTAGTAACCAGAAGGAAGTAGG + Intronic
1021988073 7:26116562-26116584 CAAAGTAAGCCAAAGAAAGTTGG + Intergenic
1023285892 7:38619223-38619245 TATAGTAACCAAAAGAAAACTGG + Intronic
1023477776 7:40599636-40599658 CTTAGAAATCAAAAGCAATTGGG - Intronic
1023906873 7:44529328-44529350 AATAGTAACCAAAAGAGAATAGG + Intronic
1024091346 7:45943810-45943832 ATAACTAACCAAAAGAAAGTTGG - Intergenic
1027744132 7:82052157-82052179 CTTCATACCCAAAAGAATGTGGG - Intronic
1030310473 7:108063978-108064000 CTGAGTACCTGAAAGAAAGTGGG + Exonic
1030474383 7:110010949-110010971 CTTTTTTACCAACAGAAAGTAGG - Intergenic
1030776521 7:113539778-113539800 CATGGTAACCAAAAGAGAGAAGG + Intergenic
1030838187 7:114314364-114314386 CTTACTAAGCAAAAGACAGCTGG - Intronic
1031174269 7:118329774-118329796 CTCAGTAACTTAAAGAAAGAAGG - Intergenic
1031764882 7:125765480-125765502 CTAAGTAGACATAAGAAAGTGGG + Intergenic
1033413215 7:141139012-141139034 TTTAGGAATAAAAAGAAAGTGGG - Intronic
1033772630 7:144569507-144569529 TTTCTTAACAAAAAGAAAGTTGG - Intronic
1034929159 7:155147459-155147481 ATTAGTAACCAAAGAAAATTAGG - Intergenic
1035466461 7:159082679-159082701 CTTAGAAACCCAAAGGAAATGGG - Intronic
1037303197 8:17475680-17475702 ATTGGTAACCAAAATAAAGCAGG - Intergenic
1037320976 8:17642234-17642256 CTTAGCTAGGAAAAGAAAGTGGG + Intronic
1039129455 8:34246604-34246626 AACACTAACCAAAAGAAAGTTGG - Intergenic
1039658379 8:39434867-39434889 CTTACAAGCCAGAAGAAAGTGGG + Intergenic
1040474930 8:47767705-47767727 ATTAGTAACCAACAGAAAGCTGG + Intergenic
1040515266 8:48129370-48129392 TCCAGTAACCAAAAGAAAGCAGG - Intergenic
1040918616 8:52590562-52590584 AATATTAATCAAAAGAAAGTAGG - Intergenic
1041336440 8:56789663-56789685 ATAAGTAACAAAAAGAAATTTGG + Intergenic
1041382401 8:57263947-57263969 CTTATCCACCAAAAGCAAGTAGG - Intergenic
1041630374 8:60081274-60081296 CTTACAAACCAGAAGAGAGTGGG - Intergenic
1043041851 8:75273915-75273937 AATAGTAACCAAAAGAGAGCTGG + Intergenic
1043142311 8:76605081-76605103 TTTACTGACCAAAAAAAAGTAGG + Intergenic
1043239259 8:77911640-77911662 CTTGGGTCCCAAAAGAAAGTTGG + Intergenic
1043434009 8:80220880-80220902 TTCAGTAATCAATAGAAAGTGGG - Intronic
1044292584 8:90490337-90490359 CCTAGAAGCCAAAAGAGAGTGGG - Intergenic
1044869102 8:96601088-96601110 CTTAGGAACCCAAAGAAATAGGG + Intronic
1045733592 8:105268821-105268843 AATAGCAACCATAAGAAAGTTGG - Intronic
1046437091 8:114205039-114205061 AATAGTAACCAAAAGAGAGCTGG + Intergenic
1048099530 8:131334854-131334876 CATAGTAACCAAAAGAGAGCAGG + Intergenic
1048939802 8:139389529-139389551 CATATTAACCAAAAGAAAACTGG + Intergenic
1050202933 9:3167393-3167415 CTTAGAAGCCAAAAGAAAAAAGG - Intergenic
1050487935 9:6154669-6154691 AATAGTAACCAAAACACAGTAGG + Intergenic
1050781663 9:9343934-9343956 TTTAATTTCCAAAAGAAAGTTGG - Intronic
1050900365 9:10940702-10940724 CTTCCTAACTAAAAGAAAGCAGG + Intergenic
1050900733 9:10945912-10945934 CTTCATAACCAGAAAAAAGTGGG + Intergenic
1051317772 9:15861095-15861117 TTTGGTAACCAAAAAAGAGTAGG - Intronic
1051526604 9:18051832-18051854 CTGAGTAGACAAAAAAAAGTAGG + Intergenic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1055151172 9:73002328-73002350 AACAGTAATCAAAAGAAAGTGGG - Intronic
1055329267 9:75165665-75165687 AATAGTAACCAAAAGAAAGCTGG - Intergenic
1055398571 9:75899104-75899126 CTTGGTAACTAAATGGAAGTAGG + Intronic
1055838151 9:80469768-80469790 CTAAGAAAGCAAAACAAAGTTGG + Intergenic
1055881096 9:81004522-81004544 CTTAGGAACACAAAGAAAGCAGG + Intergenic
1056028796 9:82529152-82529174 AATAGTAATCAAAAGAAATTTGG - Intergenic
1056349325 9:85732801-85732823 AATAGTAACCAAAAGAGAGCAGG + Intronic
1056417596 9:86391790-86391812 CTTACAAGCCAGAAGAAAGTGGG + Intergenic
1056493790 9:87135677-87135699 CTCAGTGACCAAAATATAGTTGG + Intergenic
1056582260 9:87898365-87898387 CTTAGAAACCAGAAGTCAGTAGG + Intergenic
1056734284 9:89192531-89192553 GATAGTAACCAAAAGAAAGAAGG + Intergenic
1056739309 9:89239907-89239929 GATAGTAACCAAAAGAAAAATGG - Intergenic
1056952226 9:91050313-91050335 CATGGAAACCAAAAGAGAGTGGG + Intergenic
1057007777 9:91575778-91575800 CTCTGTACCCAAAAGAAAATTGG + Intronic
1057106080 9:92418482-92418504 CCTAGTAAGCAAGAGAAACTGGG - Intronic
1057280178 9:93704337-93704359 AATAGTAACCAAAAGAGAGATGG - Intergenic
1057451485 9:95165593-95165615 ATCAGTAACAAAAAGAAAATTGG - Intronic
1057822714 9:98344775-98344797 TGTAGTAACCCAGAGAAAGTGGG - Intronic
1058173790 9:101714159-101714181 TTTAGAAGCCAAAAGAAAATTGG + Intronic
1058997127 9:110309973-110309995 TTTATTAAGAAAAAGAAAGTGGG + Intronic
1059622060 9:116016984-116017006 CTAAGCAAGCAAAAGAAAATTGG - Intergenic
1060162767 9:121381473-121381495 ATTAGGAAGCAAAAGAAAGGAGG + Intergenic
1060564160 9:124574807-124574829 CGTAGTATCCAAAAGGGAGTGGG - Intronic
1061314592 9:129787011-129787033 CTTAGAAAGCAAAACATAGTGGG - Intergenic
1186663422 X:11693252-11693274 AATATTAATCAAAAGAAAGTTGG - Intergenic
1187352006 X:18527766-18527788 CTTAGGAAAGAAAAGAAAGAAGG - Intronic
1187754407 X:22505452-22505474 CTGATAAACCAAAAGAAAATCGG - Intergenic
1187896752 X:23989155-23989177 TGTAGAAAACAAAAGAAAGTAGG - Intronic
1188515841 X:30984933-30984955 CTTAGTAAGAAAAAAAAAATAGG + Intergenic
1188707117 X:33348227-33348249 AATAGTGACCAAAAGAAAGCAGG - Intergenic
1189980281 X:46503658-46503680 CTTAGTAACCAAAATAAAATTGG + Intronic
1190445526 X:50520192-50520214 CTTCTTAACCAAGAGAAAGCAGG + Intergenic
1190518028 X:51244803-51244825 AATGGTAACCAAAAGAAAGCAGG + Intergenic
1190849311 X:54223254-54223276 AGCAGTAACCAAAAGAAAGCTGG + Intronic
1191595557 X:62940179-62940201 CTTAAAAACAAAAAGAAAGGTGG - Intergenic
1191610890 X:63111940-63111962 CTTAATCACCAAAATCAAGTAGG + Intergenic
1191855802 X:65625580-65625602 AATAGTAACCAAAAGATAGCTGG - Intronic
1192826089 X:74697521-74697543 CTTACAAGCCAAAAGAGAGTGGG + Intergenic
1192907559 X:75567479-75567501 AATAGTAACTAAAAGAAAGTAGG - Intergenic
1193118910 X:77802790-77802812 AATAGTAATCAAAAGAGAGTGGG - Intergenic
1193307787 X:79970621-79970643 AATAGAAACCAAAAGTAAGTAGG - Intergenic
1193706575 X:84827339-84827361 AGTAGTAACCAAAAGACAGCAGG - Intergenic
1193746350 X:85286620-85286642 ATTTCTAATCAAAAGAAAGTTGG + Intronic
1193784313 X:85740672-85740694 CCTAGAAGCCAAAAGAAGGTGGG + Intergenic
1193928461 X:87521303-87521325 GTTGCTATCCAAAAGAAAGTAGG + Intronic
1193980403 X:88175500-88175522 CTTACAAAGAAAAAGAAAGTAGG + Intergenic
1194039168 X:88918426-88918448 GTAAGCAACCAAAAGAAACTAGG - Intergenic
1194073325 X:89355069-89355091 CTTATTAACTAAAAAAAATTCGG - Intergenic
1194116396 X:89904082-89904104 TTTAGCAACCACAATAAAGTAGG + Intergenic
1194371006 X:93071370-93071392 CTTAATATTCAAAAGAAACTGGG - Intergenic
1194589576 X:95782426-95782448 CATACTAATCAGAAGAAAGTTGG + Intergenic
1195060920 X:101193835-101193857 CAAACTAACCAAAAGAGAGTTGG - Intergenic
1195374023 X:104208242-104208264 AATAATAACCAAAAGAAAGGTGG + Intergenic
1195581006 X:106502587-106502609 CTTAGGAACAAAAGGAAAGGCGG - Intergenic
1195889275 X:109673971-109673993 CTTAATCACCATAAGAGAGTTGG + Intronic
1196355191 X:114783302-114783324 ATTAGTAACTGAAAGAAAGATGG + Intronic
1196895062 X:120327998-120328020 TGCAGTAACCAAAAGAGAGTTGG - Intergenic
1197341557 X:125281477-125281499 ATTAGTAACAAAATGAAAGCTGG - Intergenic
1197941862 X:131798526-131798548 AAAAGTAACCAAAAGAAAATTGG - Intergenic
1198446257 X:136718186-136718208 CATACTAATCAAAAGAAAGCTGG + Intronic
1200607625 Y:5286312-5286334 CTAAGTAAAAAAAACAAAGTTGG - Intronic
1200678801 Y:6183259-6183281 CTTAATATTCAAAAGAAACTGGG - Intergenic
1200731828 Y:6751237-6751259 CTTACTAACCAGAAGAGATTGGG - Intergenic
1200803497 Y:7408492-7408514 CCTAGAAACCAGAAGACAGTGGG + Intergenic