ID: 996999984

View in Genome Browser
Species Human (GRCh38)
Location 5:129747975-129747997
Sequence CTCACACACATGTACATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996999984 Original CRISPR CTCACACACATGTACATGGA GGG (reversed) Intergenic
902521541 1:17020533-17020555 GTCACAAACCTGTGCATGGAGGG - Intronic
903571673 1:24310383-24310405 CTCACACACACATACACAGAAGG - Intergenic
905262590 1:36730122-36730144 CCCACACACATGCACATGGATGG + Intergenic
905544167 1:38784521-38784543 CTCCCACCCATGTACATACATGG + Intergenic
906682492 1:47738922-47738944 CACACACACACGTAGATGGGTGG + Intergenic
911585749 1:99688661-99688683 CTCACATACAAGAACATGAAGGG + Intronic
913166304 1:116189804-116189826 CACACACACACGTGCATGCAAGG + Intergenic
913422313 1:118684823-118684845 CACACATATATGTTCATGGATGG + Intergenic
914747700 1:150511807-150511829 CAATCACACCTGTACATGGAAGG + Exonic
915671670 1:157494421-157494443 CTCACAGACATGTACATCAATGG - Intergenic
916589754 1:166178842-166178864 GACACACACATATACATGCAGGG - Intergenic
916692693 1:167205948-167205970 CACAAACACATATACATGCAGGG - Intergenic
917431845 1:174977581-174977603 CACACACAGATGCACATGGAGGG - Intronic
918127409 1:181596546-181596568 CACACACACACGTACATGGTGGG - Intronic
918443802 1:184596144-184596166 CTCATACACATGCACATGAGAGG - Intronic
918508669 1:185285753-185285775 TCCACATACATGTATATGGATGG - Intronic
919048030 1:192478307-192478329 CACACACACATGCACATATATGG + Intergenic
920544405 1:206803419-206803441 GACGCACACATGTTCATGGAGGG - Intronic
920780293 1:208984393-208984415 CTCACACAGTTCTACATGGCTGG - Intergenic
921175871 1:212594019-212594041 GTCACACACATCCACCTGGAAGG + Intronic
921467588 1:215508409-215508431 CTTGCACAAATGTACATGGCAGG - Intergenic
922795844 1:228339066-228339088 CACACACACACGTCCATGCATGG + Intronic
923542983 1:234902672-234902694 CACACACACACAAACATGGAGGG + Intergenic
924882348 1:248174526-248174548 TTCACACTCATCTACAAGGAAGG + Intergenic
1063790099 10:9434954-9434976 CACACTCTCATATACATGGAAGG - Intergenic
1064512111 10:16106331-16106353 CACACACACATATACATATATGG - Intergenic
1065123182 10:22547588-22547610 CTCTCACCCATCTCCATGGATGG + Intronic
1067043824 10:42973490-42973512 GTCACACACAGGTACAGGGCTGG - Intergenic
1067972028 10:50983136-50983158 CACACACACATACACATGGGTGG + Intergenic
1068062658 10:52088587-52088609 CTCACACACTGGGAGATGGAAGG - Intronic
1068353081 10:55874947-55874969 CTCACTAACATGTACCTGCAAGG - Intergenic
1069782950 10:70968327-70968349 CCCACACACATGTGAATGGGTGG - Intergenic
1069885141 10:71618801-71618823 CACACACACAGGCACATGGTGGG - Intronic
1069920468 10:71812708-71812730 CCCACACACATGTACAAGGGAGG - Intronic
1070286863 10:75089974-75089996 TTCAAACACAGGTAGATGGAGGG - Intergenic
1074593244 10:114835064-114835086 CTAACACACATGTAAATAAAAGG - Intronic
1075517539 10:123120528-123120550 CTCACACACATATACACACATGG + Intergenic
1076255036 10:129016181-129016203 CACACAAACATATACATGCAAGG - Intergenic
1078525144 11:12095034-12095056 CTCAAACACATGTTGATGAAAGG + Intronic
1078545974 11:12247215-12247237 CTCACACTCAGGGACAGGGAGGG + Intronic
1079762491 11:24347491-24347513 CACACACACACATACATAGAGGG + Intergenic
1080455094 11:32411464-32411486 ATGACACAAATGTACATGCATGG + Intronic
1082623653 11:55456775-55456797 CTAAAACACATGGATATGGATGG - Intergenic
1084890611 11:72235167-72235189 CTCACAGTCAAGTCCATGGATGG + Exonic
1085962606 11:81480432-81480454 CACCCACACATGTGCATGCATGG + Intergenic
1086374123 11:86183248-86183270 CTCAGACACATGTAAACGGGAGG + Intergenic
1086454982 11:86952274-86952296 CACAACCACATGTGCATGGAAGG - Exonic
1087556153 11:99723276-99723298 CTCGGACAAATGTACATGGCTGG + Intronic
1089199673 11:116716386-116716408 CACACACACAAGTATATGTATGG - Intergenic
1089394347 11:118126100-118126122 CACACACATATGTACATTCATGG + Intergenic
1089976928 11:122740708-122740730 CCCACACACATGTACACAGATGG - Intronic
1092071675 12:5636643-5636665 CACACACGCATGCACAGGGAGGG + Intronic
1092551095 12:9500980-9501002 TTCACACACATGTTGATGGATGG + Intergenic
1093682771 12:22022176-22022198 CACACACATATATACATGTATGG + Intergenic
1094520721 12:31185399-31185421 TTCACACACATGTTGATGGATGG - Intergenic
1095226789 12:39686813-39686835 CTCACACATATGAACATAGGTGG + Intronic
1097460465 12:59855879-59855901 CACATACACACATACATGGATGG - Intergenic
1099541171 12:83909767-83909789 TGCACACACATGTACGTAGAAGG + Intergenic
1100057536 12:90530831-90530853 CACACACACATATACGTGTATGG + Intergenic
1100669705 12:96797737-96797759 TTTAAACACAGGTACATGGAAGG - Intronic
1100711153 12:97258295-97258317 CACACACACAAGTACATTGGTGG + Intergenic
1101239818 12:102826678-102826700 CACACACACATGTACACACATGG - Intergenic
1101975378 12:109353623-109353645 CCCACACACATGCACAGGGGTGG + Intronic
1102518855 12:113466901-113466923 CTCACACACAGGTACACTCACGG - Intronic
1104191537 12:126486240-126486262 CTGAAATCCATGTACATGGAGGG - Intergenic
1104633133 12:130421679-130421701 CACACACACATATAAATGCAGGG - Intronic
1106775153 13:33001701-33001723 CTCACACAGTGGTTCATGGAAGG - Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108560307 13:51636707-51636729 CTCACTCACATGTATCTAGATGG - Intronic
1110072774 13:71198532-71198554 CTCACAAAAATATATATGGATGG + Intergenic
1113439307 13:110315208-110315230 ATCACACACCTGCACATGGCTGG + Intronic
1113733157 13:112657135-112657157 CACACAGACAAGGACATGGAGGG + Intronic
1114552939 14:23544545-23544567 CCCACACACGTGTACATGGAGGG - Intronic
1114753935 14:25237300-25237322 CTCATGCACATATACATGTATGG - Intergenic
1114753938 14:25237373-25237395 CTCATGCACATATACATGCATGG - Intergenic
1114753939 14:25237430-25237452 CTCATGCACATATACATGCATGG - Intergenic
1116499665 14:45605442-45605464 TTCACACACATGTTGATGTATGG + Intergenic
1118802405 14:69202430-69202452 AGCACACACAAGTACATGAATGG - Intronic
1119179084 14:72592560-72592582 CTCACCCACACCTACATTGAGGG + Intergenic
1120104850 14:80481793-80481815 ATCACATACATCTAAATGGATGG - Intronic
1122421319 14:101579290-101579312 CCCACAGACATGTACAAGGGAGG + Intergenic
1123711675 15:22992512-22992534 CACACACACATGTATATTAATGG + Intronic
1124231176 15:27947526-27947548 CTCACACAGATGCACCTGGAAGG + Intronic
1125636775 15:41195763-41195785 TTGACACACAGGTACATGAAGGG - Exonic
1126203642 15:46018239-46018261 CACACACACACTTACATGCATGG - Intergenic
1126384515 15:48080365-48080387 ATCACACACATGTACACGTATGG + Intergenic
1128876080 15:71202464-71202486 CACACACACACGTACACAGATGG + Intronic
1130856785 15:87846553-87846575 CACACACACATGCAGATGTATGG - Intergenic
1132626432 16:893865-893887 CTCACACACTGGTGCATGGGAGG + Intronic
1138584330 16:57960470-57960492 CTCAGACCCAGGTACAGGGAGGG - Exonic
1138768223 16:59630045-59630067 CTCACACATATGAACAGAGATGG - Intergenic
1139012998 16:62656469-62656491 CTCACATACATGTGCAGGGTAGG - Intergenic
1141172868 16:81702146-81702168 CTCACACATGTGTACACAGAAGG + Intronic
1141339675 16:83191558-83191580 CACACACACATATATATGAAGGG + Intronic
1141819252 16:86433694-86433716 CACACACACTTGCACATGTATGG + Intergenic
1144435988 17:15241460-15241482 CTCATGAACATGCACATGGAAGG - Intronic
1145162489 17:20585020-20585042 CTCACAAGCATGGACAGGGACGG + Intergenic
1146642234 17:34550153-34550175 CTCACACAGCTGTCCATGGCTGG - Intergenic
1147343998 17:39774998-39775020 CTCACAGACTTGTACATGGGAGG + Intronic
1148947434 17:51276557-51276579 CTAACACTGATGTACATTGATGG + Intronic
1149297297 17:55272530-55272552 CCCACACACAACCACATGGAAGG - Intronic
1152316262 17:79582334-79582356 CACACACACACATACATGTAGGG - Intergenic
1152404803 17:80091087-80091109 CTCACACAAATGCACAGGCAGGG + Intronic
1155090752 18:22507602-22507624 CTCACATTCAGGTAAATGGATGG - Intergenic
1155846575 18:30715596-30715618 CACACACACAGACACATGGAAGG + Intergenic
1156770113 18:40709971-40709993 CACACACACATATATATGGTGGG - Intergenic
1156778201 18:40819549-40819571 CTCAGCCACATGAACAGGGAAGG - Intergenic
1158470399 18:57730846-57730868 CACACACACATACACAAGGATGG + Intronic
1159199114 18:65160669-65160691 CACACACACATATATATGTATGG - Intergenic
1159457013 18:68671556-68671578 CTCACACACATGGGCATGGATGG + Intergenic
1160197645 18:76769999-76770021 CGCACTCACCTGTACTTGGAAGG - Intergenic
1160719638 19:591528-591550 CTCACACACGCGACCATGGAGGG + Intronic
1161563240 19:4985412-4985434 CTCCCAAACATCCACATGGATGG - Intronic
1162315354 19:9935495-9935517 CACACACACACGTGCATGGATGG + Intronic
1164245348 19:23423364-23423386 CACACACACGTGCACATGGTGGG - Intergenic
1164308713 19:24028182-24028204 CACACACACGTGCACATGGTGGG + Intergenic
1165089013 19:33372968-33372990 CTCGCACCCATGCACCTGGAAGG + Intergenic
1165330286 19:35138097-35138119 CGCACGCTCATGTAGATGGATGG - Intronic
1166315520 19:41987445-41987467 CACACACGCATGTGCACGGAGGG - Intronic
1166343259 19:42151000-42151022 CACACACACATATCCATGGTGGG + Intronic
1167714886 19:51136907-51136929 CTCACTGAGATCTACATGGAAGG + Intergenic
1167962041 19:53113863-53113885 CTCACAAAAGTGTACCTGGAGGG - Intronic
1168140899 19:54386324-54386346 TTTACACACATGTTTATGGAAGG + Intergenic
927487240 2:23496817-23496839 CTCACAGAAATGCAAATGGATGG - Intronic
928739330 2:34331583-34331605 CACACACACTTGTGCATGCACGG - Intergenic
928739334 2:34331661-34331683 CACACACACACGTGCATGCACGG - Intergenic
928739338 2:34331687-34331709 CACACACACACGTACATGCACGG - Intergenic
929445336 2:41996748-41996770 CCCACACACAACTTCATGGATGG - Intergenic
932073105 2:68640614-68640636 CGCACACACATACACATGAAGGG + Intergenic
932461839 2:71887248-71887270 CTCTCAGACATGTTCATAGACGG - Intergenic
933160986 2:79025066-79025088 CTCACACAAAGGTAGCTGGAAGG + Intergenic
933494385 2:83030079-83030101 CTGACACACCTGCAAATGGAAGG + Intergenic
936865638 2:117073618-117073640 CACACACACATATACAAGGGTGG + Intergenic
937211485 2:120275254-120275276 CACACACACATTCACATGGCTGG - Intronic
937383967 2:121408822-121408844 CTAAAACAGATGTACATGAAAGG + Intronic
941431306 2:165417558-165417580 CTCACACAGGTGTACAGGGAAGG - Intergenic
941954890 2:171194102-171194124 CTTACACACCAGTACATGAAGGG + Intronic
942418970 2:175787966-175787988 CTCACACACATGTACACACGCGG - Intergenic
942468958 2:176239898-176239920 CTCAGGCACATGTAGATGGAAGG + Intergenic
942979468 2:182061994-182062016 CTCCTACACATGTATGTGGAGGG - Intronic
943501316 2:188693187-188693209 CCCACACACATGTACCAGCAAGG + Intergenic
944049359 2:195449873-195449895 CACACACACATATACATATAGGG + Intergenic
945018958 2:205551907-205551929 CCCTCACACATGGGCATGGAAGG - Intronic
947100814 2:226619517-226619539 CTCACACACATTTTCCTGGCTGG - Intergenic
947604777 2:231478914-231478936 CTCACACTCATGTTCTTAGAGGG - Intronic
947834457 2:233165332-233165354 CTCACACACATAGATATGGGTGG - Intronic
948312555 2:236999638-236999660 CTCACAGACATGCAAATGGATGG + Intergenic
1169046886 20:2540362-2540384 CTCAAAGACATGGACATGGCCGG + Intronic
1169349718 20:4858464-4858486 CACACACACAAATAGATGGAAGG - Intronic
1171489051 20:25503802-25503824 CACACACGCATGTATATGGGAGG - Intronic
1173631491 20:44519662-44519684 GTCACACACCTGTACTGGGAAGG + Intronic
1173703514 20:45093724-45093746 CTCTCACACATGGGCCTGGATGG + Exonic
1176252261 20:64131153-64131175 CTCACACACATGAACATGCCTGG - Intergenic
1176252276 20:64131317-64131339 CTCACACACATGAACACGCCTGG - Intergenic
1176252282 20:64131395-64131417 CTCACACACATGAACACGCCTGG - Intergenic
1176864594 21:14038744-14038766 CACACACACACAAACATGGAAGG - Intergenic
1176982404 21:15398239-15398261 CTCACAGACCTCCACATGGATGG + Intergenic
1178016002 21:28346756-28346778 CTCACAGACCTCTACATGAATGG - Intergenic
1179071661 21:38077091-38077113 CTCACACACACGACCATGCATGG + Intronic
1181048021 22:20224776-20224798 CACACACACGTGCATATGGACGG + Intergenic
1182265343 22:29110426-29110448 GCAACACACATGTACAGGGAGGG + Intronic
1182313031 22:29422774-29422796 AGGACACACAGGTACATGGACGG + Intronic
1184241980 22:43215908-43215930 CTCACACACATGCACACGTGTGG + Intronic
951051674 3:18100774-18100796 CACACACACCTTTACATGTATGG - Intronic
951219992 3:20058694-20058716 TTCACACAGTTGTACATGGAAGG - Intronic
951773730 3:26285773-26285795 CTCACCCCCATGCACAAGGAGGG + Intergenic
953233735 3:41087609-41087631 CCCACACACTTGTGCATGGATGG + Intergenic
954633803 3:52060691-52060713 CACATACACATATACATGTAAGG + Intergenic
955261017 3:57390478-57390500 CTGATACACAGCTACATGGAGGG + Intronic
957153476 3:76517199-76517221 CTCACATATATGTACATACATGG - Intronic
957294055 3:78313094-78313116 CACACACACATGCAAATAGATGG - Intergenic
957767123 3:84639572-84639594 CTCACACAGCTGGACATGAAGGG + Intergenic
958890268 3:99775344-99775366 TTCCCAAACATGCACATGGATGG - Intronic
959423952 3:106162541-106162563 CACACACAGATGTACCTGCAGGG + Intergenic
959975305 3:112452390-112452412 CTAACACACATGCAGATGCATGG + Intergenic
960614600 3:119585233-119585255 TTCACAAAAATGTTCATGGATGG - Intronic
962067303 3:131995213-131995235 CTCACACACCTGTTCATTTAAGG + Intronic
962187163 3:133272261-133272283 CACACACACACGTACGTGTATGG - Intronic
964297018 3:155245089-155245111 CACACACACATGCGCCTGGAAGG + Intergenic
964977144 3:162635218-162635240 CACACACACATATATATCGAGGG + Intergenic
965642693 3:170847288-170847310 CTCTTACACATGGACATGGGGGG - Intronic
966472700 3:180309533-180309555 ATCACACACATTAACAGGGAAGG + Intergenic
967430309 3:189376513-189376535 CACACAATTATGTACATGGATGG - Intergenic
968040365 3:195583707-195583729 CTCAAACAAATGTACAAGGTAGG - Intronic
969608874 4:8216192-8216214 CTCATCCACATGGACTTGGATGG - Exonic
972876775 4:43371947-43371969 CACACACACATGCACATGCATGG - Intergenic
973169459 4:47121197-47121219 CCAACACACATGGACATGGAGGG - Intronic
974633561 4:64528479-64528501 TTCCTATACATGTACATGGATGG - Intergenic
977378257 4:96236951-96236973 CTCACACATATGAGCATAGATGG - Intergenic
977956171 4:103029171-103029193 CTTACACACATGAACAAGCATGG - Intronic
978870917 4:113576526-113576548 CCCACACACAAGTACACAGAAGG + Intronic
979755641 4:124337382-124337404 CTCACACAAATCTACATTGTAGG - Intergenic
979869439 4:125800330-125800352 CTGATACTCATGTACATGGGTGG + Intergenic
980076967 4:128303971-128303993 CACACAGACAGTTACATGGATGG - Intergenic
980819625 4:137996527-137996549 CTCACAGACATGTAAATTAATGG - Intergenic
982571544 4:157056981-157057003 CTCATACACATGTACATATAGGG + Intergenic
983976966 4:173946447-173946469 CTCACACACATGTATATTCATGG + Intergenic
986441740 5:7788690-7788712 CACACACACATGCACACAGATGG - Intronic
986750681 5:10784556-10784578 CACACACACACATACATGAAAGG + Intergenic
986921184 5:12683768-12683790 CACACACACATATATATGAAAGG - Intergenic
988109759 5:26803900-26803922 CTCACACATATGTATATACATGG - Intergenic
988598470 5:32617357-32617379 CTCACACACAACAGCATGGACGG - Intergenic
989441158 5:41473895-41473917 CTCTCATAAATTTACATGGAAGG - Intronic
990022053 5:51139943-51139965 CACACACACATATACACAGAGGG + Intergenic
990216813 5:53542409-53542431 CAAACACACATGTACATATATGG + Intergenic
990665250 5:58064753-58064775 CACACACACAGGTACATATATGG + Intergenic
990697554 5:58437830-58437852 CACACACTCATGCACATGAATGG + Intergenic
991925650 5:71702928-71702950 GTCACACACATGCTCATTGAAGG - Intergenic
993649236 5:90498145-90498167 CACACACACACATACATGGGGGG - Intronic
994763117 5:103881584-103881606 CACACACACATGTATGTGTAGGG - Intergenic
996999984 5:129747975-129747997 CTCACACACATGTACATGGAGGG - Intergenic
999546810 5:152638204-152638226 CCCACATATATGTACATGCATGG + Intergenic
999690943 5:154145358-154145380 CACACACACATGCACATGCCCGG + Intronic
1001657206 5:173360788-173360810 CTCACAGACATATGCAGGGAAGG - Intergenic
1001860027 5:175046265-175046287 CACACACACATGTAGGTAGACGG + Intergenic
1003232267 6:4265277-4265299 CTCACACAAATGAACATGTGAGG + Intergenic
1003485763 6:6577627-6577649 CACACACACATATACACAGAGGG - Intergenic
1004271802 6:14202318-14202340 CACACACACATATACATAGAGGG + Intergenic
1005893740 6:30160938-30160960 CACCCACACATGCACATGGCTGG + Intergenic
1008929253 6:56920400-56920422 GTCACACACATCTGCATGAAAGG + Intronic
1010634548 6:78241498-78241520 TACACACACATATACATAGATGG + Intergenic
1011828146 6:91335141-91335163 CACACACACATGCACATGGATGG + Intergenic
1012135138 6:95546136-95546158 CTCACACACATATGTATGCATGG + Intergenic
1014113235 6:117644796-117644818 CTCAGGCACCTGTACCTGGATGG + Intergenic
1015065410 6:129020395-129020417 TACACGCACATGTACCTGGAAGG + Intronic
1015069874 6:129079023-129079045 CTCACACACACGTACATATATGG + Intronic
1018583551 6:165331212-165331234 CACACACATATATATATGGATGG - Exonic
1018740428 6:166724107-166724129 GTCATACACATGCACATGTATGG + Intronic
1018851395 6:167643020-167643042 CTAACATATATCTACATGGAAGG - Intergenic
1019141370 6:169946678-169946700 CACACACACATGTAAAAGGATGG + Intergenic
1019593800 7:1849067-1849089 CACACACAAATGCACATGCACGG + Exonic
1020433672 7:8139299-8139321 GTCACACACTTGTCCATGGAAGG - Intronic
1022717681 7:32913602-32913624 AACACACACATGTAAATGCACGG - Intergenic
1022727495 7:32994461-32994483 CTAACACACATGGACAGGGTGGG - Intronic
1023274805 7:38506885-38506907 CCCTCACACATTTCCATGGAAGG - Intronic
1024823679 7:53364415-53364437 CACACACACATATATATGTATGG + Intergenic
1025046091 7:55693188-55693210 CTAACACACATGGACAGGGTGGG + Intergenic
1026621069 7:71950335-71950357 GTCACCCACAGATACATGGAAGG + Intronic
1026665605 7:72337435-72337457 CACACACGCATGCACATGCACGG + Intronic
1031244328 7:119288733-119288755 CACACACACATACATATGGAGGG - Intergenic
1031702068 7:124938665-124938687 CTCACACATAGGAACCTGGAGGG - Intergenic
1032936767 7:136741668-136741690 CACACACACATATGTATGGAGGG + Intergenic
1035161509 7:156953636-156953658 TACACACATATGTACGTGGAAGG - Intronic
1035205232 7:157290379-157290401 CCCACTCACAGGTGCATGGACGG - Intergenic
1035722879 8:1805337-1805359 CTCACTCACCTGTACAAGGAAGG + Intergenic
1036235758 8:7038076-7038098 TTCAGACACATGTATATGAAAGG - Intergenic
1036386488 8:8286245-8286267 ATCACACATATTTACATGGCGGG + Intergenic
1037107493 8:15127279-15127301 CACACACACATATACATACATGG + Intronic
1037244014 8:16810554-16810576 CACACACACATATACATTAAAGG + Intergenic
1042509307 8:69594380-69594402 GTCACACACATTTACAGGTATGG - Intronic
1043137041 8:76540614-76540636 TAAATACACATGTACATGGAGGG + Intergenic
1043801121 8:84610860-84610882 CATACACACATGTACATTGACGG - Intronic
1044385973 8:91588549-91588571 CTCACACAAATGTCAATGGGTGG + Intergenic
1044766656 8:95583064-95583086 ATCACACACATGTCCATTGATGG + Intergenic
1045183756 8:99815110-99815132 CATGCACACATGTACATGCATGG + Intronic
1045375605 8:101571007-101571029 CTCACACTGCTGCACATGGAAGG - Intronic
1045671266 8:104556010-104556032 CTCAAACCCATGCAAATGGATGG + Intronic
1047541573 8:125771692-125771714 CACACATACATGTACACAGAAGG + Intergenic
1049536001 8:143182732-143182754 TGCACACACATGCACATGCATGG - Intergenic
1049735146 8:144200990-144201012 GTCACACATATGTAAATTGAGGG - Intronic
1050340226 9:4629991-4630013 GACACACACAACTACATGGATGG + Intronic
1050987041 9:12095501-12095523 CACACACACATATACATAAAGGG + Intergenic
1056035279 9:82598201-82598223 CACACACACATGCACACAGAGGG - Intergenic
1057090339 9:92252390-92252412 CTCACACACACGTATCTAGAAGG - Intronic
1060239816 9:121893338-121893360 CACACACACATATGCATGCATGG - Intronic
1185954966 X:4479263-4479285 TTCACACACACATACATGCATGG + Intergenic
1186264035 X:7812240-7812262 CTGACACACATGAACAAGGTAGG + Intergenic
1186423909 X:9448590-9448612 CACACACACACATACAGGGAGGG + Intergenic
1187818990 X:23265040-23265062 CTCACACTGGTGTACAAGGATGG - Intergenic
1195962871 X:110403475-110403497 CGCACACACATGCACATGCCCGG + Intronic
1198574346 X:137993561-137993583 CTCATACCCATGGATATGGAAGG - Intergenic
1199689214 X:150295011-150295033 ATCACAGACATGAACATGCAAGG + Intergenic
1201503104 Y:14667461-14667483 CACACACACACATACATGCAGGG + Intronic