ID: 997000300

View in Genome Browser
Species Human (GRCh38)
Location 5:129751511-129751533
Sequence TCTAGGAAAATAAGCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997000294_997000300 22 Left 997000294 5:129751466-129751488 CCAAAGTGCTCAATTATAGGCAT 0: 1
1: 8
2: 103
3: 734
4: 1783
Right 997000300 5:129751511-129751533 TCTAGGAAAATAAGCAGTGATGG 0: 1
1: 0
2: 1
3: 21
4: 318
997000293_997000300 23 Left 997000293 5:129751465-129751487 CCCAAAGTGCTCAATTATAGGCA 0: 1
1: 7
2: 102
3: 749
4: 1696
Right 997000300 5:129751511-129751533 TCTAGGAAAATAAGCAGTGATGG 0: 1
1: 0
2: 1
3: 21
4: 318
997000297_997000300 -7 Left 997000297 5:129751495-129751517 CCATGCCTGGCCTCAATCTAGGA 0: 1
1: 0
2: 5
3: 67
4: 653
Right 997000300 5:129751511-129751533 TCTAGGAAAATAAGCAGTGATGG 0: 1
1: 0
2: 1
3: 21
4: 318
997000291_997000300 26 Left 997000291 5:129751462-129751484 CCTCCCAAAGTGCTCAATTATAG 0: 1
1: 15
2: 231
3: 1716
4: 2194
Right 997000300 5:129751511-129751533 TCTAGGAAAATAAGCAGTGATGG 0: 1
1: 0
2: 1
3: 21
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997000300 Original CRISPR TCTAGGAAAATAAGCAGTGA TGG Intronic
901651083 1:10743615-10743637 TCTATAAAAATAAGGAGGGAGGG + Intronic
902913818 1:19623219-19623241 TTGAGGAAAATAAGTAGTAAAGG - Intronic
903320426 1:22539751-22539773 TCTAGGAAATTAAGCGGTCTAGG + Intergenic
903863766 1:26382638-26382660 TAAAGGAAAATAAGCATTGTTGG + Intergenic
907533755 1:55128530-55128552 TCTAGGTAAATAAGGAGGGAAGG - Intronic
907701071 1:56788842-56788864 TAGATGAGAATAAGCAGTGATGG + Intronic
908277856 1:62494715-62494737 TTTAAGAAAATAACCAGTTAAGG + Intronic
908400236 1:63765997-63766019 TCTAGGAAAAAGATAAGTGAAGG - Intergenic
909205498 1:72751972-72751994 TCTGGAAAAATATGCTGTGAAGG + Intergenic
910845622 1:91602051-91602073 GCTAGGAAGATAAGCCCTGAGGG + Intergenic
911622718 1:100084773-100084795 TCAAGGAAAATACGCTATGAAGG + Exonic
912676934 1:111690564-111690586 TATTGGATAATAAGCAGTGTAGG - Intronic
915567755 1:156725688-156725710 TCGAGGTTAATAAGAAGTGAAGG - Intronic
918849392 1:189666202-189666224 TCTTGGAAGCTAAGCAGTGTCGG - Intergenic
920242365 1:204562467-204562489 TCTCGGAAACTAAGCAGGGTCGG - Intergenic
920271265 1:204766021-204766043 TCCAGGAGAGTAAGCAGTGAAGG - Intergenic
920627219 1:207613845-207613867 TCTAAGAAAAAAAGAAGGGAGGG - Intronic
920944588 1:210516251-210516273 TTTAAGAAGATAAGCTGTGAAGG + Intronic
921193960 1:212734718-212734740 TTTAGGCAAATAATCAGGGAAGG - Intronic
922442326 1:225666159-225666181 TTCTGGAAAATAAGCAGAGAGGG - Intergenic
1063698777 10:8364423-8364445 TCTATGAAGTTAAGCAGTGAGGG + Intergenic
1063940091 10:11119652-11119674 CCTAGGAAAAAAATGAGTGAGGG + Intronic
1063996738 10:11626841-11626863 TGCAGGAAAATAAGCAGGGTAGG - Intergenic
1064710878 10:18123274-18123296 TCTAGGCTAATAAGCATTGAGGG - Intergenic
1064718207 10:18199351-18199373 TCTAGGAAGAAAAGCAGAGAAGG + Intronic
1064718491 10:18202991-18203013 TCAAGGAAAATGTTCAGTGATGG - Intronic
1064804154 10:19111812-19111834 TCAAGTAAAATAAGGATTGAGGG + Intronic
1064804500 10:19115181-19115203 TCTAGGAGAAGAAGCAGGGGAGG - Intronic
1067153597 10:43756210-43756232 TCCATGAAAATGAGGAGTGAGGG - Intergenic
1069207004 10:65702202-65702224 TCAACAAAAATAAACAGTGAAGG + Intergenic
1069246584 10:66214786-66214808 TCTAAGTAAAAAAGAAGTGATGG + Intronic
1069311335 10:67041467-67041489 TTTAGGAATATAAGAATTGATGG - Intronic
1070386149 10:75926482-75926504 TCTAGGAAAACCAGGAGTGCAGG - Intronic
1071030136 10:81168696-81168718 TATAGGAAAAGAAGAAGTAAAGG - Intergenic
1072056766 10:91766030-91766052 TCAAGGAGAATAAGAAGTCATGG + Intergenic
1072746831 10:97946119-97946141 TCTAGGAAAAGAAGAAGACAGGG + Intronic
1073849497 10:107598346-107598368 TATAAGAATATAAGCAGTAAAGG - Intergenic
1074634692 10:115301543-115301565 GCTGGGAAAATAAACAGTGCTGG + Intronic
1075193721 10:120335797-120335819 TCTGGGAAAATAAGCAGTTTAGG + Intergenic
1075959522 10:126556475-126556497 TATATCAAAATAAGCAATGAAGG - Intronic
1076160277 10:128238307-128238329 TTTAGGAAGATCAGAAGTGAGGG + Intergenic
1080321329 11:31013672-31013694 TATGTGTAAATAAGCAGTGAAGG - Intronic
1081022597 11:37966521-37966543 TCTACAATAATAAGCAGTGGGGG + Intergenic
1084191449 11:67500910-67500932 TCTAGGAAATAAAGTAATGATGG + Intronic
1084234397 11:67777429-67777451 TCTAGGAAATCCAGCATTGAAGG + Intergenic
1084472497 11:69371258-69371280 TCCAGGAAAAGAAGCAGTGGTGG + Intergenic
1085163475 11:74372380-74372402 ACTAGGAAAATTTGCAGTCATGG + Intronic
1086315243 11:85584509-85584531 TCTAGGAAGATAACCAGTAGTGG + Intronic
1086374073 11:86182988-86183010 TCTAGGTCCATATGCAGTGATGG + Intergenic
1086438125 11:86801022-86801044 TCAAGGAAAAGAAGTAGTGGTGG - Intronic
1087256310 11:95958206-95958228 TCTAGAAGAATAACCAGTAAGGG + Intergenic
1087849607 11:103012879-103012901 TCAAGGAAAATATCCTGTGAAGG + Intergenic
1090856438 11:130612810-130612832 TGTGGGAAAAGAAGAAGTGAGGG - Intergenic
1092205277 12:6611039-6611061 TCTAGGAAAATGAGATGAGAAGG - Intergenic
1092551297 12:9503275-9503297 TCTATGAAAATCAACAGTGTAGG - Intergenic
1092613905 12:10198980-10199002 ACTATGAAAGTAAGCAGTGTAGG + Intergenic
1093382852 12:18516173-18516195 TCTAGAAAAATAAAAACTGAAGG - Intronic
1094257656 12:28452477-28452499 GCTTGAAAAAGAAGCAGTGAAGG + Exonic
1094520510 12:31183058-31183080 TCTATGAAAATCAACAGTGTAGG + Intergenic
1094748354 12:33374235-33374257 TCTAGGAAAAAAAAGAGTAAGGG - Exonic
1095044599 12:37487537-37487559 AAAAGTAAAATAAGCAGTGAAGG - Intergenic
1095090949 12:38104354-38104376 TCTGGGAATATACGCAGTAATGG + Intergenic
1095370153 12:41457640-41457662 ACAAGGAAAATAAGCATTGATGG - Intronic
1095432725 12:42151402-42151424 TCTAGGAATTAAAGAAGTGAAGG + Intergenic
1095660102 12:44722639-44722661 TGTTTGAAAATAAGCACTGAGGG + Intronic
1097317712 12:58189777-58189799 TCTTTAAAAATAAGCAATGAGGG - Intergenic
1097668153 12:62505053-62505075 TCTAGAAAAATAAGCTTTAAGGG + Intronic
1098649087 12:72941567-72941589 TCAAGAATAATAAGCAGTGGTGG - Intergenic
1098882708 12:75932580-75932602 TGTAGGAAAATAGGAACTGATGG - Intergenic
1099018017 12:77368800-77368822 TAAAGGAAAATAAGGAATGAAGG - Intergenic
1099136338 12:78908136-78908158 TCAAGGAAAATAATCTGTCAAGG + Intronic
1099161541 12:79247853-79247875 TCTAGGAAGATGCACAGTGAAGG + Intronic
1099199010 12:79653776-79653798 TCTTAAAAAATAAGCACTGAGGG - Intronic
1099218112 12:79878358-79878380 TCTAGGAAGCTAAGCAGGGTTGG - Intronic
1100138061 12:91579396-91579418 TCTGAGAAAATAAGCACTGAGGG - Intergenic
1100167804 12:91938023-91938045 TCTAGGAATAGAAGGAGTGTAGG - Intergenic
1100276101 12:93073108-93073130 TCCTGGAAAAAAAGCAGTGATGG - Intergenic
1100278077 12:93090355-93090377 TCAAGAAAAATAAGCAGAGTAGG + Intergenic
1101095554 12:101335942-101335964 TCTATGCAAATAAGCCATGAAGG + Intronic
1103111047 12:118278645-118278667 TTTAGGTAAATAACCAGTAATGG + Intronic
1103352652 12:120295721-120295743 TGAAGGAAAACAGGCAGTGAGGG - Intergenic
1104755724 12:131268229-131268251 TCTGGGAAATTTAGCAGGGAAGG - Intergenic
1104777981 12:131402452-131402474 TCCAGGAAATTTAGCAGGGAAGG + Intergenic
1107279730 13:38719919-38719941 TCAAAGAAATTAACCAGTGATGG - Intronic
1109590287 13:64470726-64470748 TGTGGGAAAATAAGCAGAGCAGG - Intergenic
1111608572 13:90574481-90574503 TCTAGGAATTCAACCAGTGAAGG - Intergenic
1111947492 13:94681214-94681236 TCTGGGGAAAAAAGCAGTGGAGG + Intergenic
1112140415 13:96635270-96635292 TCCAGGCAAATAAGCACTTAAGG - Intronic
1112908946 13:104458551-104458573 TGCAGGAACATAAGCAGTCAAGG + Intergenic
1112976966 13:105332120-105332142 TCTTGGAAAATATACAGAGAAGG - Intergenic
1113344492 13:109462715-109462737 TATAGCTAAATAAGCTGTGAAGG - Intergenic
1113908998 13:113832990-113833012 TCAAGGGAAATGAGCAGGGAAGG - Intronic
1114690768 14:24577973-24577995 TCTGGGTAAATATCCAGTGATGG + Intergenic
1115351872 14:32404643-32404665 TCTAGGATAATGAAGAGTGATGG + Intronic
1116340918 14:43722359-43722381 TCTGGGATAATAAGCCATGAAGG + Intergenic
1116368063 14:44094050-44094072 TATAGTAGAAAAAGCAGTGAAGG - Intergenic
1116487527 14:45468566-45468588 TCTATGAAAACTAACAGTGAAGG + Intergenic
1116731229 14:48624913-48624935 TTTATGAAAATAAGCAGTAGAGG + Intergenic
1116759549 14:48994199-48994221 TCTAGGAAAATAAGAGTTTAGGG + Intergenic
1117244355 14:53869247-53869269 TCTGGGTATATAAGCAGTAATGG - Intergenic
1117643655 14:57827785-57827807 TTTTGAAAAATAAGGAGTGAAGG - Intronic
1119133301 14:72194208-72194230 GCTAGGAAAGAAAGCAGTGTGGG + Intronic
1119333478 14:73813163-73813185 TCTAGGGAAATAATCAGTCTAGG + Intergenic
1121901244 14:97695158-97695180 TCTGGGAAAATCAGCAGCAAAGG - Intergenic
1121961297 14:98262631-98262653 TTTAGGAAATTAAGGAGTTAAGG - Intergenic
1125399432 15:39284573-39284595 CCTAAGACACTAAGCAGTGATGG + Intergenic
1126290308 15:47068514-47068536 AAAAGTAAAATAAGCAGTGAAGG + Intergenic
1127636798 15:60878745-60878767 TCTAGAAAAATAAGCACAGTAGG - Intronic
1127858569 15:62973586-62973608 CCTGGGAAAATTAGCAATGAAGG + Intergenic
1128741352 15:70085969-70085991 TCTAGGAAAAGAAGCAGGTAAGG + Intronic
1129168516 15:73793525-73793547 GCTAAGGAAATAAGGAGTGACGG - Intergenic
1131044973 15:89307003-89307025 GCTAGGAACATAAACAGTAAGGG - Intronic
1131957565 15:97752786-97752808 TGTAGGAGAAAAAGGAGTGATGG - Intergenic
1132004578 15:98215130-98215152 TTTTAGAAAACAAGCAGTGATGG - Intergenic
1134348411 16:13413453-13413475 TCTAGGTAAATTTGCAGTGTTGG + Intergenic
1135946060 16:26865984-26866006 TCTAGGAGATAAAGCTGTGAAGG - Intergenic
1137869289 16:51934004-51934026 TTAAGGAAGATAAACAGTGAGGG + Intergenic
1138502139 16:57453401-57453423 TCTGGGAAAATAAGATGTGTTGG - Intronic
1139430991 16:66910961-66910983 TCTAGGAGAATGATCAGAGAGGG + Intronic
1140997987 16:80279612-80279634 TCTGGGAATGTCAGCAGTGATGG + Intergenic
1143122271 17:4615986-4616008 TCTTCGAAAAGAAGCTGTGAAGG - Intergenic
1144141519 17:12353107-12353129 CCTAGGAAAACAATCAGTTAAGG + Intergenic
1144534475 17:16074403-16074425 TTTAGGAAAATAAACAGAAATGG + Intronic
1147438051 17:40430081-40430103 TGTAGGAAAAGATGCAGGGAAGG + Intergenic
1147507648 17:41035385-41035407 TTTAGGCACATAATCAGTGATGG - Intergenic
1147510121 17:41060904-41060926 TCTAGGTCAATAATCAGGGAAGG - Intergenic
1148204972 17:45774503-45774525 TCAAGGAAGAAAAGCAGTGAAGG - Intergenic
1149110759 17:53026953-53026975 TTTAGGAATACAAGCACTGAAGG - Intergenic
1150045520 17:61909407-61909429 TCTATAAAAATAAGAAGTAAGGG - Intronic
1150463207 17:65370466-65370488 TCCAGGGAAAAAGGCAGTGAAGG - Intergenic
1151402222 17:73863201-73863223 TCCAGGAATGGAAGCAGTGAGGG + Intergenic
1151488497 17:74417640-74417662 TCTAGGAAGCTAAGCAGGGTTGG - Intergenic
1153657621 18:7298495-7298517 TGTAGGAAAAGAAGCAATAAGGG - Intergenic
1156053966 18:32975122-32975144 ATGAGGAAAAAAAGCAGTGATGG - Intronic
1156080631 18:33330502-33330524 TCTAGGAATTTAAGATGTGATGG + Intronic
1156570541 18:38247177-38247199 ACTAGAAAATTAAGCAGAGATGG - Intergenic
1156729905 18:40180174-40180196 TCTAGGAGAAGAAAAAGTGAGGG - Intergenic
1156766172 18:40658578-40658600 TCAAGGAAAATAAGCAAGGAAGG + Intergenic
1161105838 19:2443549-2443571 TCTGGGAGAATGAGCAGTGTGGG + Intronic
1161452923 19:4356543-4356565 TCTAAGAACATAAAAAGTGAAGG + Intronic
1162619713 19:11832108-11832130 TCTATGAATGTAAGCAGTGTGGG + Exonic
1164215235 19:23138914-23138936 TGTAGGAAAATAAGCAAATAGGG + Intronic
1164275151 19:23710592-23710614 ACTAGACAAATAAGCAGTTAAGG + Intergenic
1166427284 19:42690201-42690223 TCTAGGAAAAATAGTGGTGATGG - Intronic
1166436300 19:42768725-42768747 TCTAGGAAAAATAGTGGTGATGG - Intronic
1166453560 19:42920902-42920924 TCTAGGAAAAATAGTGGTGATGG - Intronic
1166456048 19:42940214-42940236 TCTAGGAAAAATAGTGGTGAGGG - Intronic
1166465835 19:43029483-43029505 TCTAGGAAAAATAGTGGTGATGG - Intronic
1166646603 19:44536690-44536712 TCTAGGAATTTAAGGAGTCATGG - Intergenic
925485162 2:4320433-4320455 TCTGGGAAGATAACCAGTAATGG + Intergenic
925547150 2:5029123-5029145 GCTAGGATAATGATCAGTGATGG + Intergenic
926227748 2:10980493-10980515 TTTAGGCAAATAATCAGAGAAGG + Intergenic
926953128 2:18265689-18265711 TCTAGGAAAATACACAGGGTTGG + Intronic
927175279 2:20401660-20401682 TCTTGGAAACTAAGCAGAGTCGG - Intergenic
933851338 2:86369007-86369029 TCTAGGAAAAAATGCACTGTGGG + Intergenic
935504209 2:103879783-103879805 TCTAGGAATATGAGCAGGAAAGG + Intergenic
936902322 2:117495794-117495816 TCTAAGAAAAGAAGTAATGAGGG - Intergenic
937150528 2:119682902-119682924 TCAAGGGAAATAAGCAGGGCAGG - Intronic
939865701 2:147470040-147470062 TTTAGGAAAATTGGAAGTGAGGG - Intergenic
940042456 2:149374902-149374924 ACCAGGAAAGAAAGCAGTGAAGG + Intronic
942527141 2:176865974-176865996 TCTAGTAAAATAAGCTGGAAAGG + Intergenic
942557178 2:177183897-177183919 TGAAGGGAAATAAGCAGAGATGG + Intergenic
946676489 2:222165538-222165560 TCTTGGAAAATAAGCTCTGTAGG - Intergenic
946958735 2:224960282-224960304 TCAAGGAAAATAAAGAGTGCAGG - Intronic
947417545 2:229913324-229913346 TTTAGACAAATAAGCTGTGATGG + Intronic
947895147 2:233664184-233664206 GATAGAAAAATCAGCAGTGAGGG - Intronic
1169596607 20:7207160-7207182 TCTAGGAATGTAAGAATTGAAGG + Intergenic
1169638735 20:7724452-7724474 TCTAGGAAAAAAAACAGTAAAGG + Intergenic
1170406527 20:16043846-16043868 TCTAAGAAAATAAAGAGAGAAGG - Intronic
1171539139 20:25931150-25931172 AAAAGTAAAATAAGCAGTGAAGG - Intergenic
1171801892 20:29629103-29629125 AAAAGTAAAATAAGCAGTGAAGG + Intergenic
1171842085 20:30226474-30226496 AAAAGTAAAATAAGCAGTGAAGG - Intergenic
1171943221 20:31351047-31351069 ACCAGGACAATAAGCAGAGAAGG + Intergenic
1172246796 20:33451008-33451030 TTTATGCAAATGAGCAGTGAGGG + Intergenic
1173097530 20:40050904-40050926 ACTAGGATAATGAGCAGTAATGG - Intergenic
1173590861 20:44223697-44223719 TCTAAGAAAATAATCAGACAAGG - Intergenic
1174176379 20:48647884-48647906 TCCAGGGAAATAAAAAGTGATGG - Intronic
1174477384 20:50805640-50805662 TCTAAGAAAAACAGCAGTGCAGG - Intronic
1174585941 20:51608433-51608455 TCAAAGAAAAAAAGCAGGGAGGG + Intronic
1175410276 20:58763173-58763195 TCTAGGGAAACAAGCAGATAAGG + Intergenic
1176890263 21:14308349-14308371 TCTATCAAAATAAGCACAGATGG - Intergenic
1176942845 21:14944633-14944655 TGAAGGCAAATAAGCACTGAAGG + Intergenic
1178203896 21:30441031-30441053 TCTGGGAAAATAATGAGAGAAGG - Intergenic
1181968019 22:26670128-26670150 ACTAGGAAAATAGGTAGGGAAGG - Intergenic
1182107613 22:27700543-27700565 GCCAGGAAAAAAAGCAGTAATGG - Intergenic
1182552316 22:31107025-31107047 TCCAGGAAAACATGAAGTGATGG + Intronic
1182750171 22:32635135-32635157 TCTTGGAAACTAAGCAGGGTCGG - Intronic
949402678 3:3682381-3682403 TCTAGGAAAATAATCAGACTAGG - Intergenic
949471507 3:4401480-4401502 GCTTGGAAAGTAGGCAGTGATGG - Intronic
950402767 3:12782720-12782742 CCAATGCAAATAAGCAGTGAGGG + Intergenic
951307530 3:21084015-21084037 TCTAAGAAAATAAGCAAGGCAGG + Intergenic
953151806 3:40331983-40332005 GCTAGGGAAATAATCAGAGATGG + Intergenic
953728683 3:45426134-45426156 TCTATGAAAATAAGGTGTCAAGG - Intronic
957365554 3:79218357-79218379 TATAAGAAAATAGGAAGTGATGG - Intronic
958050142 3:88334641-88334663 TCAAGGGAAATAAGCAGTGGAGG + Intergenic
959052025 3:101533554-101533576 TTTTGGAAAATAATCAGTAAAGG + Intergenic
959232776 3:103677486-103677508 TCTAGGGAAATTATTAGTGAAGG + Intergenic
959480196 3:106863352-106863374 ACTTGGAAAATAAGAAGTTACGG + Intergenic
960827155 3:121800946-121800968 TCTAGGAAAAGAATCACTTATGG - Intronic
961589290 3:127963650-127963672 TCTTGGAAACTAAGCAGGGTCGG + Intronic
961884024 3:130083974-130083996 TCTAGGAAATCCAGCATTGAAGG + Intronic
963625390 3:147665439-147665461 TCTATCAAAATAAGTAGCGATGG - Intergenic
963671889 3:148261347-148261369 ACCAGGTAAAGAAGCAGTGATGG + Intergenic
964084451 3:152799141-152799163 TTTAGGGAAAGAAGCAGAGAAGG - Intergenic
965733363 3:171795640-171795662 GCTAGGAAATTAAGCAGGAATGG - Intronic
966606098 3:181822926-181822948 TCTCGGAAGCTAAGCAGTGTCGG - Intergenic
967903728 3:194484528-194484550 TCAGTGAGAATAAGCAGTGATGG + Intronic
968198937 3:196735437-196735459 TTTAGGAAATGGAGCAGTGATGG - Intronic
968250843 3:197211745-197211767 TCTAGGTATATAACCAGTAATGG - Intronic
969820752 4:9718317-9718339 TCTAGGAAATCCAGCATTGAAGG - Intergenic
970541355 4:17083118-17083140 TCTAGCAACAAAATCAGTGAGGG + Intergenic
972903597 4:43716864-43716886 TCTAGGTAAAAAGGCAGAGAGGG - Intergenic
973529915 4:51826176-51826198 TCAACAAAAATAAGCAATGAGGG - Intergenic
974658151 4:64852024-64852046 TCTAGGAGAGTAAGAAATGAAGG + Intergenic
975060560 4:69992788-69992810 TCTATGAAAAAAATCTGTGATGG - Intergenic
975098972 4:70490827-70490849 ACTGGGAAAATATGGAGTGAAGG + Intergenic
976117451 4:81743291-81743313 TACAGGAAAATAAGCAGGTAAGG + Intronic
976161544 4:82205735-82205757 TCTAAAAAAATGGGCAGTGACGG + Intergenic
978120698 4:105075553-105075575 TCCAATAAAATTAGCAGTGATGG - Intergenic
978619612 4:110625512-110625534 TCTTGAAAAACAAGGAGTGAGGG - Intronic
980885950 4:138762480-138762502 TCTAGGAAAATATCTAATGATGG + Intergenic
981302015 4:143197748-143197770 TCTAGGAAAATAACCACTGTTGG + Intronic
981670902 4:147286062-147286084 TATATGAAAATCAGCAGGGAAGG + Intergenic
982457134 4:155623728-155623750 TCTAGCAAAGGAAGCAGAGAAGG - Intergenic
982927804 4:161361290-161361312 TCTGGGAAGACAAGGAGTGATGG + Intergenic
983195794 4:164805069-164805091 TCAAGGAAAATAAGAAGATAGGG + Intergenic
983375200 4:166918420-166918442 TCTAGGAAGCTAAGCAGGGCTGG - Intronic
984518768 4:180775141-180775163 TCTAGGAAAATAAACAGTATAGG + Intergenic
984568488 4:181360784-181360806 TGAAGTAAAATCAGCAGTGAAGG + Intergenic
988777433 5:34490210-34490232 CCTAAGATATTAAGCAGTGAAGG - Intergenic
989107520 5:37877736-37877758 TCTAAGAAAAGAAGCAGAAAGGG + Intergenic
990189611 5:53244336-53244358 ACTATGAAAATAAGCACTGGAGG - Intergenic
992521852 5:77561358-77561380 TCTAGGTTAATAAGAAGTGTTGG - Intronic
992551189 5:77861837-77861859 TCTATGAAAATGAGCAGAAAAGG - Intronic
993832223 5:92774749-92774771 CCTAAGCAAATAAGCAGAGAAGG + Intergenic
994600385 5:101895079-101895101 TTAAGGAGAATAAGCAGGGAGGG - Intergenic
994935763 5:106251465-106251487 TCTTGGAAAGCAAGCAGAGAAGG - Intergenic
996322873 5:122239099-122239121 TGAAGGAAAAAAACCAGTGATGG + Intergenic
996406058 5:123105214-123105236 TGTAAGAAAATATGCAGTTATGG - Intronic
997000300 5:129751511-129751533 TCTAGGAAAATAAGCAGTGATGG + Intronic
998083845 5:139299894-139299916 TCTTGGAAGCTAAGCAGTGTTGG + Intronic
998099506 5:139420355-139420377 GCTAGGGAAATAAGAAGTGTTGG - Intronic
998517293 5:142768171-142768193 TCTATGCTAATGAGCAGTGAGGG + Intergenic
998916640 5:147019898-147019920 TCAAGGAAAACATGCTGTGAGGG + Intronic
1002383423 5:178847652-178847674 CCTAGGAAAGTAAGGATTGATGG + Intergenic
1003810867 6:9778988-9779010 TTTAAGAAAATAAGCACAGAAGG - Intronic
1004577373 6:16910118-16910140 TCTAGGAAAATAGCCAGGAATGG + Intergenic
1004704229 6:18108912-18108934 TCAAGGAAAATAAAGAGGGATGG + Intergenic
1005464708 6:26101179-26101201 TCTAGAAAAGTAAGGAGTGGAGG + Intergenic
1006955467 6:37866414-37866436 TCTAAGAAAAAAAGAAGTGGGGG - Intronic
1008077487 6:47160185-47160207 TCTAGGAAAATAATCATCCATGG - Intergenic
1008501953 6:52191823-52191845 TCTAGGATAACAGGCAGTGATGG - Intergenic
1008786873 6:55178671-55178693 TTTAGGAAAATATGCAATTAAGG - Intronic
1009723797 6:67510034-67510056 TCTTGGAAAATACTGAGTGAAGG - Intergenic
1010360276 6:74985629-74985651 TCTAGGAAATTAATCTTTGAAGG - Intergenic
1010548739 6:77192573-77192595 ACTAGGAATATACACAGTGATGG + Intergenic
1010771428 6:79836077-79836099 TGTAGCAAAAAAAGAAGTGAAGG - Intergenic
1010910551 6:81549936-81549958 TCTATGAAAATAATCAGAGTGGG - Intronic
1011517603 6:88169058-88169080 TCAAGGATAATAATCAGTAATGG + Intergenic
1012144425 6:95664086-95664108 CCTTGGAAAGTAATCAGTGAAGG - Intergenic
1013387081 6:109642409-109642431 ACTAGGGAATTAATCAGTGAAGG - Intronic
1013627930 6:111956090-111956112 TCTAAGCAGATAAGAAGTGATGG + Intergenic
1015348293 6:132185796-132185818 TCTAGGTAAATATCCAGTCATGG - Intergenic
1015382332 6:132583744-132583766 TCCAAGAAAGTAAACAGTGAGGG + Intergenic
1016668268 6:146669989-146670011 GCAAGGAAAATGAGCAATGAAGG - Intronic
1016691884 6:146947611-146947633 TCTATGAGAAGAAGAAGTGAAGG - Intergenic
1017478207 6:154821518-154821540 TCTAAGAAAAAAATCAGGGAAGG + Intronic
1017544073 6:155432648-155432670 CCCAGGAAAAAAAGCAGAGAGGG - Intronic
1017657487 6:156643861-156643883 TCAAGGAAAAAAAGCAGCAAAGG - Intergenic
1017965863 6:159265470-159265492 GCAAGGAAAATAAGCTGTAATGG - Intronic
1019170986 6:170133108-170133130 TCTAGGTAGATGAGAAGTGAGGG - Intergenic
1019191391 6:170253067-170253089 TTCAGGAAAATAAGCAGAGGGGG - Intergenic
1020442153 7:8229236-8229258 GTTGGGAAAATAAGGAGTGATGG - Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021773776 7:24031298-24031320 TTTAGTAAAATAAGCAGTGAAGG + Intergenic
1022159781 7:27698024-27698046 TCTAGGAACATAAACAATCAAGG - Intergenic
1022189321 7:28001779-28001801 TTTAGAAAAATAACCAGTGGTGG + Intronic
1022740432 7:33114810-33114832 TCTCGGAAAAAAAGCGGGGAAGG - Intergenic
1023325542 7:39051834-39051856 TCTAGAAAAATAAACACTCATGG - Intronic
1023759271 7:43448602-43448624 TCCAGGCAGACAAGCAGTGAGGG + Intronic
1025290530 7:57717079-57717101 AAAAGTAAAATAAGCAGTGAAGG - Intergenic
1026271259 7:68839085-68839107 TCTACGAATATATGCACTGAAGG - Intergenic
1030764384 7:113390669-113390691 GCTGGGAAAATATGGAGTGAGGG + Intergenic
1030800970 7:113851397-113851419 TTTAGGAAGAAAAGCAGAGAGGG + Intergenic
1031008846 7:116502671-116502693 GCTAGGAAAATATGCAGTAGTGG + Intronic
1031185717 7:118477287-118477309 TCTAGGAAAATAACTGGTAAAGG + Intergenic
1033633266 7:143182526-143182548 ACTAGGAAAATAAGAGTTGAAGG - Intergenic
1033859124 7:145603357-145603379 TCTAGGAAAATAGAAAATGAAGG - Intergenic
1035085790 7:156256670-156256692 TCTAGTAAAATTAGAAGAGACGG - Intergenic
1035884864 8:3280906-3280928 TATAGAAAAAAAAGAAGTGATGG + Intronic
1037031906 8:14118084-14118106 TCTAGGTATATAACCAGTAATGG + Intronic
1037896684 8:22661200-22661222 TCTAGGATAACAAGGAGAGAAGG - Intronic
1038697307 8:29817930-29817952 CCTAGGAAAAGCAGCAGTTAAGG - Intergenic
1039184734 8:34904578-34904600 TCTAGGAGGATTTGCAGTGAGGG - Intergenic
1040659153 8:49548974-49548996 TTTATGTTAATAAGCAGTGAGGG + Intronic
1043027190 8:75084650-75084672 TTTTGGAAAATTAGCAGGGAGGG - Intergenic
1043818355 8:84831613-84831635 TGTAGAAAAATAATCAGGGAAGG + Intronic
1044489380 8:92793934-92793956 TTTAGGGTAATATGCAGTGAGGG + Intergenic
1045201337 8:99984894-99984916 TCCAGGAGAATAATCAATGATGG - Intronic
1046226027 8:111282137-111282159 TTTAGGAGAAAAAGCATTGAAGG + Intergenic
1048114111 8:131501372-131501394 TCTTGGGAAATAACTAGTGATGG - Intergenic
1048888892 8:138930971-138930993 TCTGGGAGAAAAAGCAGTGCTGG + Intergenic
1049123689 8:140766001-140766023 TATATGAAAGGAAGCAGTGAGGG - Intronic
1049938891 9:525761-525783 TATAGGAGAATAAGCAGCAAAGG + Intronic
1050163052 9:2737816-2737838 TCTAGGAGGATGAGCAGGGAAGG - Intronic
1050180178 9:2914051-2914073 TTTAGGTATAAAAGCAGTGAGGG + Intergenic
1051259620 9:15250279-15250301 TCTAGATAATTAAACAGTGATGG - Intronic
1051872298 9:21752385-21752407 TCTAGGAAAAAAAGAAGTCAGGG + Intergenic
1054165908 9:61728296-61728318 AAAAGTAAAATAAGCAGTGAAGG + Intergenic
1054951475 9:70856941-70856963 TTTAGGAAAGGAAGCAGTGTTGG - Intronic
1057865640 9:98678341-98678363 TCTAAGTAAATAAGCGGTTAGGG - Intronic
1058160047 9:101560073-101560095 TCTAGCAAAATCAGCATAGAAGG - Intronic
1058472208 9:105291700-105291722 TCTGGGAAAAGTAGCAGTGATGG + Intronic
1058497468 9:105575686-105575708 TCTAGTACAATTATCAGTGATGG - Intronic
1058849803 9:109000681-109000703 TCTAGGAGAAGAAACAGTGGAGG + Intronic
1058920872 9:109613519-109613541 TCTAGGAGAGGAAGCAGGGAAGG - Intergenic
1059095719 9:111411678-111411700 TCTTGGAAACTAAGCAGGGTCGG - Intronic
1185935051 X:4247076-4247098 TATAGGTAAATAAGCCTTGAAGG + Intergenic
1186284623 X:8030215-8030237 TCTTGGCAAATGGGCAGTGAGGG - Intergenic
1186388477 X:9133870-9133892 TCTTGGAAACTAAGCAGGGTTGG + Intronic
1186393915 X:9188781-9188803 TCTTGGAGAATAAGCAGGTATGG - Intergenic
1186572278 X:10727808-10727830 TCTGTGAGAATAAGCAGTGCTGG + Intronic
1186922721 X:14300057-14300079 TTAAGGAAAATAAGCAATGCAGG - Intergenic
1186943462 X:14538648-14538670 TCCAAGAAAATAATCAGAGATGG - Intronic
1187755952 X:22526681-22526703 TCTATTAAAATCAGCACTGAGGG - Intergenic
1188250924 X:27893332-27893354 TATCCTAAAATAAGCAGTGAAGG - Intergenic
1188290862 X:28387022-28387044 TCTAAGAAAATAACGAGTGTTGG + Intergenic
1189644644 X:43114809-43114831 TTTGGGGAAATAAGTAGTGATGG - Intergenic
1189718670 X:43892122-43892144 TCTAGGAAAAAAAATAGTGGTGG + Intergenic
1189959615 X:46311955-46311977 TCTAGGAAGAAATGCAGTGAAGG + Intergenic
1190476954 X:50837696-50837718 TCTACAAAACTAAGCAGAGAGGG + Intergenic
1190585018 X:51931374-51931396 TCAGGTAAAGTAAGCAGTGATGG + Intergenic
1191249640 X:58254274-58254296 TTTGGGAAAAGAAGCAGTCAGGG - Intergenic
1192693427 X:73389397-73389419 TCCAGGTAAATAAGAACTGAGGG + Intergenic
1192807867 X:74525647-74525669 TCCAGGAAAGTAAGCAGTAGGGG + Intronic
1193882790 X:86945157-86945179 TCAAGGTAAATAAACAGTGGTGG + Intergenic
1194900265 X:99500772-99500794 TCTACAAAAATAAGCAATGGGGG + Intergenic
1198015374 X:132605012-132605034 TCTAGGAAACAGAGGAGTGAGGG - Intergenic
1199412416 X:147539677-147539699 TCTGGGTTAATAAACAGTGAAGG + Intergenic
1200905820 Y:8481005-8481027 TCCAGGAAGCTGAGCAGTGATGG - Intergenic
1201467837 Y:14304093-14304115 TCAAGGCACAGAAGCAGTGAAGG + Intergenic